RosBREEDSNP_SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3, RosBREEDSNP_SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3
dbSNP IDss475876792
SNP Array ID
480K SNP array for apple:AX-105204218
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3
50K SNP array for apple:AX-105204218
TypeSNP
SNP AllelesK
5' Flanking SequenceAAAAGTAAAGGATTGATCCACAAAAGGTGCAGAAT
3' Flanking SequenceTTTGCTTACAAGGGCAAACCCTGGGAAGATACAGA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
480K SNP array for appleSNP_chip
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A36.05SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3View
2Apple_HC64_F11N/A31.11SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3View
3Apple_HCMO_F11N/A22.9SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3View
4Apple_HGMM_Consenus1N/A26.46SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3View
5Apple-RosBREED-3.9K-20191N/A23.02SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3View
6Apple-BB-F11N/A29.75SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3View
7Apple-NC-F11N/A45.5SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3View
8Apple-NCZFBB-consensus1N/A27.14SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3View
9Apple-ZF-F11N/A29.71SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3View
10Apple-MM-F11N/A25.7c475876792View
11Apple-Honeycrisp_Consensus-F11N/A23.02RosBREEDSNP_SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3View
Sequence
>RosBREEDSNP_SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3 ID=RosBREEDSNP_SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3; Name=RosBREEDSNP_SNP_GT_18056530_Lg1_01783_MAF30_1629293_exon3; organism=Malus x domestica; type=genetic_marker; length=75bp
AAAAGTAAAGGATTGATCCACAAAAGGTGCAGAAT[G/T]TTTGCTTACA
AGGGCAAACCCTGGGAAGATACAGA