RosBREEDSNP_SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1, RosBREEDSNP_SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1
dbSNP IDss475879671
SNP Array ID
480K SNP array for apple:AX-115182560
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1
20K SNP array for apple:RosBREEDSNP_SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1
50K SNP array for apple:AX-105219078
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1.probe: TTTAGTTAATGATATGGATGTCACTAAAAGCACAAGGCATTACCTTCAGA
5' Flanking SequenceGAGAGGCATGGTGACACATCAGAAGATGATTATTCAAAATTCTTACATTTGAGATTTGTA G
3' Flanking SequenceTCTGAAGGTAATGCCTTGTGCTTTTAGTGACATCCATATCATTAACTAAAGAAACAATAT C
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
MDC010254.241contigMDC010254.241:7727..7727 .Malus x domestica Whole Genome v1.0 Assembly & Annotationn/a
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F110N/A55.53SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1View
2Apple_HC64_F110N/A76.65SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1View
3Apple_HCMO_F110N/A15.26SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1View
4Apple_HGMM_Consenus10N/A14.26SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1View
5Apple-RosBREED-3.9K-201910N/A13.07SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1View
6Apple-MM-F110N/A17c475879671View
7Apple-Honeycrisp_Consensus-F110N/A13.07RosBREEDSNP_SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1View
Sequence
>RosBREEDSNP_SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1 ID=RosBREEDSNP_SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1; Name=RosBREEDSNP_SNP_CT_9480406_Lg10_00875_MAF30_268401_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
TGATTATTCAAAATTCTTACATTTGAGATTTGTAG[C/T]TCTGAAGGTA
ATGCCTTGTGCTTTTAGTGACATCC