RosBREEDSNP_SNP_CA_29926704_Lg15_RosCOS1232_MAF50_MDP0000283141_exon1, RosBREEDSNP_SNP_CA_29926704_Lg15_RosCOS1232_MAF50_MDP0000283141_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CA_29926704_Lg15_RosCOS1232_MAF50_MDP0000283141_exon1
dbSNP IDss475881550
SNP Array ID
480K SNP array for apple:AX-115182396
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CA_29926704_Lg15_RosCOS1232_MAF50_MDP0000283141_exon1
20K SNP array for apple:RosBREEDSNP_SNP_CA_29926704_Lg15_RosCOS1232_MAF50_MDP0000283141_exon1
50K SNP array for apple:AX-105175172
TypeSNP
SNP AllelesT/G
Probe 1RosBREEDSNP_SNP_CA_29926704_Lg15_RosCOS1232_MAF50_MDP0000283141_exon1.probe: GAAACAAAAGTAGAGACTGTTGCAGTAACAAATTTGCATGAACGGTCCCC
5' Flanking SequenceGCAATTGCTTTTGTCAAAGGAAAAATGCAAAAGTTGCTTCCAGTCCAGTCTCATCTAAAA A
3' Flanking SequenceGGGGACCGTTCATGCAAATTTGTTACTGCAACAGTCTCTACTTTTGTTTCACATATCGAC G
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F115N/A85.6a475881550View
Sequence
>RosBREEDSNP_SNP_CA_29926704_Lg15_RosCOS1232_MAF50_MDP0000283141_exon1 ID=RosBREEDSNP_SNP_CA_29926704_Lg15_RosCOS1232_MAF50_MDP0000283141_exon1; Name=RosBREEDSNP_SNP_CA_29926704_Lg15_RosCOS1232_MAF50_MDP0000283141_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
GCAAAAGTTGCTTCCAGTCCAGTCTCATCTAAAAA[A/C]GGGGACCGTT
CATGCAAATTTGTTACTGCAACAGT
Alignments
Feature NameTypeLocationAnalysis
MDC007151.397 contig MDC007151.397:14797..14797. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr15 chromosome Chr15:31554747..31554747. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation