GDsnp01693, GDsnp01693 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp01693
Aliasss475882285
rs267615230
GD_01693_L1_PA
a475882285
dbSNP IDss475882285
SNP Array ID
480K SNP array for apple:AX-115182062
IRSC 9K SNP array for apple:GDsnp01693
20K SNP array for apple:GDsnp01693
TypeSNP
SNP AllelesT/C
Probe 1GDsnp01693.probe: ATCCGTTGGCATCCGCCATCCAACTTCACTCTAAATTCTAATCGATTCTA
5' Flanking SequenceCTTTTGGGTCTTGTAATTTGATTATCTGCAAAAACGAAAATGTTGTGCTTTTGGGTTGTT GATTATCTGAGATGGATCAATGTTGGGTTGCATTTACTTT
3' Flanking SequenceTAGAATCGATTAGAATTTAGAGTGAAGTTGGATGGCGGATGCCAACGGATGAGTAAAGGC GAAATGTGGAGGTTGTNGTAAAGNGGGCAGTTGATCAGTT
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2014Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp01693GDsnp01693Malus x domesticamarker_locus
a475882285a475882285Malus x domesticamarker_locus
GD_SNP01693GD_SNP01693Malus x domesticamarker_locus
ss475882285ss475882285Malus x domesticamarker_locus
GDsnp01693GDsnp01693-39.404Malus x domesticamarker_locus


The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeGDsnp01693.probeMalus x domesticaprobe


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>GDsnp01693 ID=GDsnp01693|Name=GDsnp01693|organism=Malus x domestica|type=genetic_marker|length=75bp
TCTGAGATGGATCAATGTTGGGTTGCATTTACTTT[A/G]TAGAATCGAT
TAGAATTTAGAGTGAAGTTGGATGG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A18.85GDsnp01693View
2Apple_HC64_F11N/A14.57GDsnp01693View
3Apple_HCMO_F11N/A42.15GDsnp01693View
4Apple_HGMM_Consenus1N/A48.29GDsnp01693View
5Apple Integrated map1N/A61.1GDsnp01693View
6Apple-B-F1-2014B1N/A20GDsnp01693View
7Apple-FjxPL-F1-2013LG1N/A56.67GDsnp01693View
8Apple-MM-F11N/A40.3a475882285View
9Apple-GDxBr-F1-2013LG1N/A57.4GD_SNP01693View
10apple-RosBREED-sweetness-2015LG1N/A61.1ss475882285View
11Apple-Honeycrisp_Consensus-F11N/A39.4GDsnp01693-39.404View
Alignments
Feature NameTypeLocationAnalysis
MDC010675.506 contig MDC010675.506:24621..24621. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr01 chromosome Chr01:26879708..26879708+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr01 chromosome Chr01:26879658..26879758+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218