GDsnp00030, GDsnp00030 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp00030
dbSNP IDss475882565
SNP Array ID
480K SNP array for apple:AX-105177442
IRSC 9K SNP array for apple:GDsnp00030
20K SNP array for apple:GDsnp00030
50K SNP array for apple:AX-105177442
TypeSNP
SNP AllelesT/C
Probe 1GDsnp00030.probe: ACAAATGGAAAAAGCCAAGAGATGCCACTTCCATTTTGTCGAGCAGCAAC
5' Flanking SequenceAAACAGAGATAAAGGGAGAGTTTTAGCTTGAAGGTGAAGAAACACCCACTACAAATGGAA AAAGCCAAGAGATGCCACTTCCATTTTGTCGAGCAGCAAC
3' Flanking SequenceGTTGTAGGACCAGCCAAGGAGGGTATCCAGAAGAAGCCTTCTGTAAGGAGTCCCTTTATA TAGAAATGCCACACACTTAATAAGAGCTCGGAGTGATTAT
SpeciesMalus x domestica
Product Length591
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2014Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2011Micheletti D, Troggio M, Zharkikh A, Costa F, Malnoy M, Velasco R, Salvi S. Genetic diversity of the genus Malus and implications for linkage mapping with SNPs. Tree Genetics & Genomes. 2011; 7(4):857-868.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map16N/A23.9GDsnp00030View
2Apple-RosBREED-3.9K-201916N/A19.47GDsnp00030View
3Apple-Honeycrisp_Consensus-F116N/A19.47GDsnp00030View
4Apple-GDxBr-F1-2013LG16N/A15.89GD_SNP00030View
Sequence
>GDsnp00030 ID=GDsnp00030; Name=GDsnp00030; organism=Malus x domestica; type=genetic_marker; length=75bp
CAAGAGATGCCACTTCCATTTTGTCGAGCAGCAAC[C/T]GTTGTAGGAC
CAGCCAAGGAGGGTATCCAGAAGAA