|
Marker Overview
Name | RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13 |
dbSNP ID | ss475876634 |
SNP Array ID | IRSC 9K SNP array for apple: | RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13 | 50K SNP array for apple: | AX-105187703 |
|
Type | SNP |
SNP Alleles | T/C |
5' Flanking Sequence | AGTTGCTTGCACTGCTTCTCGTCATCCACTATCTG |
3' Flanking Sequence | GCCGAGGCACTAAGTACACACGTGAATGTGAAAT |
Species | Malus x domestica |
Publication | [view all] |
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2013 | Troggio M, Surbanovski N, Bianco L, Moretto M, Giongo L, Banchi E, Viola R, Fernández FF, Costa F, Velasco R, Cestaro A, Sargent DJ. Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin. PloS one. 2013; 8(6):e67407. |
2012 | Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745. |
2020 | Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8 |
Sequence
>RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13 ID=RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13; Name=RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13; organism=Malus x domestica; type=genetic_marker; length=70bp AGTTGCTTGCACTGCTTCTCGTCATCCACTATCTGYGCCGAGGCACTAAG TACACACGTGAATGTGAAAT
|