RosBREEDSNP_SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1, RosBREEDSNP_SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1
dbSNP IDss475879353
SNP Array ID
480K SNP array for apple:AX-115182339
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1
20K SNP array for apple:RosBREEDSNP_SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1
50K SNP array for apple:AX-105180559
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1.probe: TTCTACGCAAACTGTGGTAAAATGCCCCAAGCGCAGCTGATTTTTGATGG
5' Flanking SequenceAGCTCGCCGCTTTCTACGCAAACTGTGGTAAAATGCCCCAAGCGCAGCTGATTTTTGATG G
3' Flanking SequenceATTTTACTGAAAAACTCGTTCCTGTGGAATTTCATGATCAGGGGATATGCCTGCAATGGA T
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F19N/A28.81SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1View
2Apple_HCMO_F19N/A17.9SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1View
3Apple_HGMM_Consenus9N/A24.38SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1View
4Apple-RosBREED-3.9K-20199N/A14.76SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1View
5Apple-BB-F19N/A20.56SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1View
6Apple-NC-F19N/A24.99SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1View
7Apple-NCZFBB-consensus9N/A21.94SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1View
8Apple-ZF-F19N/A24.08SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1View
9Apple-MM-F19N/A24.7c475879353View
10Apple-Honeycrisp_Consensus-F19N/A14.76RosBREEDSNP_SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1View
Sequence
>RosBREEDSNP_SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1 ID=RosBREEDSNP_SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1; Name=RosBREEDSNP_SNP_AG_6778759_Lg9_00280_MAF40_MDP0000764434_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
GGTAAAATGCCCCAAGCGCAGCTGATTTTTGATGG[A/G]ATTTTACTGA
AAAACTCGTTCCTGTGGAATTTCAT
Alignments
Feature NameTypeLocationAnalysis
MDC016695.152 contig MDC016695.152:3455..3455. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr09 chromosome Chr09:7583783..7583783. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation