RosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1, RosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1
Aliasss475882071
rs267615016
R_8577910_L17_PA
dbSNP IDss475882071
SNP Array ID
480K SNP array for apple:AX-105177444
20K SNP array for apple:RosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1.probe: ACTCCGCTGATAAGAGTAGACATGCATATATGCAAACACCCAAACACTTT
5' Flanking SequenceGCATCAAGTTTACTCCGCTGATAAGAGTAGACATGCATATATGCAAACACCCAAACACTT T
3' Flanking SequenceGGAGGAAGCTTTGATACAAAAATAAGAGAAACATGTTTTTGTAGCACATCAAACGGTGTC T
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeRosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1.probeMalus x domesticaprobe


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1RosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1 ID=RosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1|Name=RosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1|organism=Malus x domestica|type=genetic_marker|length=75bp
GTAGACATGCATATATGCAAACACCCAAACACTTT[C/T]GGAGGAAGCT
TTGATACAAAAATAAGAGAAACATG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20135N/A70.4RosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1View
2Apple-M432-2013-physical-Malus-domestica17N/A8577910RosBREEDSNP_SNP_CT_8577910_Lg17_00039_MAF20_MDP0000409121_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC001284.349 contig MDC001284.349:2388..2388. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr17 chromosome Chr17:8649549..8649549+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218