RosBREEDSNP_SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8, RosBREEDSNP_SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8
Aliasss475881673
rs267614618
R_55332967_L15_PA
dbSNP IDss475881673
SNP Array ID
20K SNP array for apple:AX-105209978
IRSC 9K SNP array for apple:AX-105209978
480K SNP array for apple:AX-105209978
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8.probe: TCACCGGACAATTTTATAACCTTGTCACTGTTTGCTTTTTATTCTGCAGC
5' Flanking SequenceATACCATAAACTCACCGGACAATTTTATAACCTTGTCACTGTTTGCTTTTTATTCTGCAG C
3' Flanking SequenceTTAAGGAATTTTTTGTATGCTAGTCAATTAGTTACTCAACTAACAAATTGTTGGTCCCAT C
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Libraries
Library NameType
20K SNP array for appleSNP_chip
480K SNP array for appleSNP_chip
IRSC 9K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8RosBREEDSNP_SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8Malus x domesticamarker_locus
RosBREEDSNP_SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8RosBREEDSNP_SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8-101.411Malus x domesticamarker_locus


The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeRosBREEDSNP_SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8.probeMalus x domesticaprobe


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8 ID=RosBREEDSNP_SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8|Name=RosBREEDSNP_SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8|organism=Malus x domestica|type=genetic_marker|length=75bp
ATAACCTTGTCACTGTTTGCTTTTTATTCTGCAGC[A/G]TTAAGGAATT
TTTTGTATGCTAGTCAATTAGTTAC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F115N/A99.83SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8View
2Apple_HC64_F115N/A0.9SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8View
3Apple_HCMO_F115N/A0SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8View
4Apple_HGMM_Consenus15N/A129.58SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8View
5Apple-M432-201315N/A118.93SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8View
6Apple-M432-2013-physical-Malus-domestica15N/A55332967SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8View
7Apple-Honeycrisp_Consensus-F115N/A101.41RosBREEDSNP_SNP_GA_55332967_Lg15_01392_MAF20_MDP0000135349_exon8View
Alignments
Feature NameTypeLocationAnalysis
MDC018664.50 contig MDC018664.50:2510..2510. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr15 chromosome Chr15:52915782..52915782+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr15 chromosome Chr15:52915783..52915782. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218