RosBREEDSNP_SNP_AG_15345285_Lg9_Hi01e10_MAF20_MDP0000229280_exon1, RosBREEDSNP_SNP_AG_15345285_Lg9_Hi01e10_MAF20_MDP0000229280_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_15345285_Lg9_Hi01e10_MAF20_MDP0000229280_exon1
Aliasss475879435
rs267612381
a475879435
SNP_AG_15345285_Lg9_Hi01e10_MAF20_MDP0000229280_exon1
AX-105206265
dbSNP IDss475879435
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_15345285_Lg9_Hi01e10_MAF20_MDP0000229280_exon1
50K SNP array for apple:RosBREEDSNP_SNP_AG_15345285_Lg9_Hi01e10_MAF20_MDP0000229280_exon1
TypeSNP
SNP AllelesA/G
5' Flanking SequenceCAAACGAGGGTCACCCTTACACATGCCTAGTCTAC
3' Flanking SequenceCATCATTTCTCCCTTGGGTGGCGGAAGTGGCGCA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_AG_15345285_Lg9_Hi01e10_MAF20_MDP0000229280_exon1RosBREEDSNP_SNP_AG_15345285_Lg9_Hi01e10_MAF20_MDP0000229280_exon1Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_AG_15345285_Lg9_Hi01e10_MAF20_MDP0000229280_exon1 ID=RosBREEDSNP_SNP_AG_15345285_Lg9_Hi01e10_MAF20_MDP0000229280_exon1|Name=RosBREEDSNP_SNP_AG_15345285_Lg9_Hi01e10_MAF20_MDP0000229280_exon1|organism=Malus x domestica|type=genetic_marker|length=70bp
CAAACGAGGGTCACCCTTACACATGCCTAGTCTACRCATCATTTCTCCCT
TGGGTGGCGGAAGTGGCGCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20134N/A5.85RosBREEDSNP_SNP_AG_15345285_Lg9_Hi01e10_MAF20_MDP0000229280_exon1View
2Apple-M432-2013-physical-Malus-domestica9N/A15345285RosBREEDSNP_SNP_AG_15345285_Lg9_Hi01e10_MAF20_MDP0000229280_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC043079.14 contig MDC043079.14:12268..12268. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr04 chromosome Chr04:2336291..2336291. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr04 chromosome Chr04:2336289..2336289. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation