RosBREEDSNP_SNP_GA_12309737_Lg11_00441_MAF20_1653485_exon4, RosBREEDSNP_SNP_GA_12309737_Lg11_00441_MAF20_1653485_exon4 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_12309737_Lg11_00441_MAF20_1653485_exon4
dbSNP IDss475880156
SNP Array ID
480K SNP array for apple:AX-115182574
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_12309737_Lg11_00441_MAF20_1653485_exon4
20K SNP array for apple:RosBREEDSNP_SNP_GA_12309737_Lg11_00441_MAF20_1653485_exon4
50K SNP array for apple:AX-105212006
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_GA_12309737_Lg11_00441_MAF20_1653485_exon4.probe: CTTTTAATTTTTGCAGGCTGATGGTTTCCCCACGCTTCTATTCTTCCCAG
5' Flanking SequenceTAGAGAAGAATGCATTTAACAATTTTACATGCCACTTACTGGATCAAAGCTCTTATTTCC C
3' Flanking SequenceCTGGGAAGAATAGAAGCGTGGGGAAACCATCAGCCTGCAAAAATTAAAAGAACAGCAATT A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-Honeycrisp_Consensus-F111N/A25.97RosBREEDSNP_SNP_GA_12309737_Lg11_00441_MAF20_1653485_exon4View
2Apple-RosBREED-3.9K-201911N/A25.97RosBREEDSNP_SNP_GA_12309737_Lg11_00441_MAF20_1653485_exon4View
Sequence
>RosBREEDSNP_SNP_GA_12309737_Lg11_00441_MAF20_1653485_exon4 ID=RosBREEDSNP_SNP_GA_12309737_Lg11_00441_MAF20_1653485_exon4; Name=RosBREEDSNP_SNP_GA_12309737_Lg11_00441_MAF20_1653485_exon4; organism=Malus x domestica; type=genetic_marker; length=75bp
ACATGCCACTTACTGGATCAAAGCTCTTATTTCCC[A/G]CTGGGAAGAA
TAGAAGCGTGGGGAAACCATCAGCC