|
|
Marker Overview
| Name | GDsnp00795 |
|---|
| dbSNP ID | ss475882370 |
|---|
| SNP Array ID | | IRSC 9K SNP array for apple: | GDsnp00795 | | 50K SNP array for apple: | AX-105188946 |
|
|---|
| Type | SNP |
|---|
| SNP Alleles | C/T |
|---|
| 5' Flanking Sequence | AAGTTCAAAGGGAGCCTAATGGTAG |
|---|
| 3' Flanking Sequence | GGCATTGGATCCCAAGTTAATGATA |
|---|
| Species | Malus x domestica |
|---|
| Publication | [view all] |
|---|
| Contact | Cindy F. Verdu
|
|---|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
| Year | Publication |
|---|
| 2010 | Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839. |
| 2012 | Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745. |
| 2014 | Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103. |
| 2020 | Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8 |
Sequence
>GDsnp00795 ID=GDsnp00795; Name=GDsnp00795; organism=Malus x domestica; type=genetic_marker; length=201bp
GGGTCCATCACCCAGGAAGCGAAGTTTCCCAAACTTGGGAGGCTAGAAAA
GGAAAGGTTCGACGACTTAATACCCAAGTTCAAAGGGAGCCTAATGGTAG
YGGCATTGGATCCCAAGTTAATGATAGCAGCAGCACTGATGAGAATCCTG
AAGATAAACATCGAATGACCTCAGTTCGCAGGGGTCTGCATATGATCAGT
T
|
