GDsnp00109, GDsnp00109 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp00109
dbSNP IDss475882930
SNP Array ID
480K SNP array for apple:AX-105197386
IRSC 9K SNP array for apple:GDsnp00109
50K SNP array for apple:AX-105197386
TypeSNP
SNP AllelesR
5' Flanking SequenceAAATGTGTTGTTTTGGGGGAACCAAACCCGGGTGA
3' Flanking SequenceCTCCGGATCCGGTTCGGGTTTGGAGGAAGAAGGC
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
480K SNP array for appleSNP_chip
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map9N/A43.1GDsnp00109View
2Apple-BB-F19N/A35.71GDsnp00109View
3Apple-NC-F19N/A50.94GDsnp00109View
4Apple-NCZFBB-consensus9N/A39.04GDsnp00109View
5Apple-ZF-F19N/A47.05GDsnp00109View
6Apple-MM-F19N/A41.7c475882930View
7Apple-Honeycrisp_Consensus-F19N/A33.11GDsnp00109View
8Apple-GDxBr-F1-2013LG9N/A44.54GD_SNP00109View
Sequence
>GDsnp00109 ID=GDsnp00109; Name=GDsnp00109; organism=Malus x domestica; type=genetic_marker; length=75bp
AAATGTGTTGTTTTGGGGGAACCAAACCCGGGTGA[A/G]CTCCGGATCC
GGTTCGGGTTTGGAGGAAGAAGGCC