RosBREEDSNP_SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1, RosBREEDSNP_SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1
dbSNP IDss475876838
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1
50K SNP array for apple:AX-105179428
TypeSNP
SNP AllelesT/C
5' Flanking SequenceGGAAGGGAGTGACTCTAGTGGTTTCGATGGCACAA
3' Flanking SequenceTGTTTGAAGACCACTCCTCGTTGGGAGGCTTTCA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F116N/A8.2SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1View
2Apple_HC64_F116N/A18.5SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1View
3Apple_HCMO_F116N/A50.41SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1View
4Apple_HGMM_Consenus16N/A58.25SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1View
5Apple-RosBREED-3.9K-201916N/A57.02SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1View
6Apple-BB-F116N/A59.06SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1View
7Apple-NC-F116N/A72.78SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1View
8Apple-NCZFBB-consensus16N/A66.69SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1View
9Apple-ZF-F116N/A70.2SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1View
10Pear-PM-F1-Moonglow10N/A0RosBREED_SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1View
11Apple-MM-F116N/A53a475876838View
12Apple-Honeycrisp_Consensus-F116N/A57.02RosBREEDSNP_SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1View
13Pear-PH-CG-2017LG10N/A152.85RosBREEDSNP_SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1View
Sequence
>RosBREEDSNP_SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1 ID=RosBREEDSNP_SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1; Name=RosBREEDSNP_SNP_TC_23899418_Lg1_RosCOS1602_MAF20_MDP0000283296_exon1; organism=Malus x domestica; type=genetic_marker; length=70bp
GGAAGGGAGTGACTCTAGTGGTTTCGATGGCACAAYTGTTTGAAGACCAC
TCCTCGTTGGGAGGCTTTCA