RosBREEDSNP_SNP_CT_14220624_Lg9_00958_MAF50_MDP0000834237_exon2, RosBREEDSNP_SNP_CT_14220624_Lg9_00958_MAF50_MDP0000834237_exon2 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_14220624_Lg9_00958_MAF50_MDP0000834237_exon2
dbSNP IDss475883295
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_14220624_Lg9_00958_MAF50_MDP0000834237_exon2
50K SNP array for apple:AX-105212537
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTGTGCAGTGCGATACGGCTGTCACGTGCAAGGGGA
3' Flanking SequenceCGAAGGTGGGGAGCTGCACGTGAAGGAGGTAAGC
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A57.6SNP_CT_14220624_Lg9_00958_MAF50_MDP0000834237_exon2View
2Apple_HC64_F11N/A50.99SNP_CT_14220624_Lg9_00958_MAF50_MDP0000834237_exon2View
3Apple_HCMO_F11N/A0SNP_CT_14220624_Lg9_00958_MAF50_MDP0000834237_exon2View
4Apple_HGMM_Consenus1N/A0SNP_CT_14220624_Lg9_00958_MAF50_MDP0000834237_exon2View
5Apple-Honeycrisp_Consensus-F11N/A0SNP_CT_14220624_Lg9_00958_MAF50_MDP0000834237_exon2View
6Apple-MM-F11N/A0.6c475883295View
Sequence
>RosBREEDSNP_SNP_CT_14220624_Lg9_00958_MAF50_MDP0000834237_exon2 ID=RosBREEDSNP_SNP_CT_14220624_Lg9_00958_MAF50_MDP0000834237_exon2; Name=RosBREEDSNP_SNP_CT_14220624_Lg9_00958_MAF50_MDP0000834237_exon2; organism=Malus x domestica; type=genetic_marker; length=70bp
TGTGCAGTGCGATACGGCTGTCACGTGCAAGGGGAYCGAAGGTGGGGAGC
TGCACGTGAAGGAGGTAAGC