RosBREEDSNP_SNP_CT_1337720_Lg17_00864_MAF40_961431_exon1, RosBREEDSNP_SNP_CT_1337720_Lg17_00864_MAF40_961431_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_1337720_Lg17_00864_MAF40_961431_exon1
dbSNP IDss475881956
SNP Array ID
480K SNP array for apple:AX-115182436
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_1337720_Lg17_00864_MAF40_961431_exon1
20K SNP array for apple:RosBREEDSNP_SNP_CT_1337720_Lg17_00864_MAF40_961431_exon1
50K SNP array for apple:AX-105189482
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_CT_1337720_Lg17_00864_MAF40_961431_exon1.probe: CCATTTATATGCTTCCAAATGTGCTCCTCTGACTTATTGATAGTATCCCC
5' Flanking SequenceGGAAGCGTTTCCCATTTATATGCTTCCAAATGTGCTCCTCTGACTTATTGATAGTATCCC C
3' Flanking SequenceGTTAGCTTACACACCAACTTTGAACTGCACAAGGAAAGCAAATGAACCAGGTTTCAGCAT A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F117N/A4.4b475881956View
Sequence
>RosBREEDSNP_SNP_CT_1337720_Lg17_00864_MAF40_961431_exon1 ID=RosBREEDSNP_SNP_CT_1337720_Lg17_00864_MAF40_961431_exon1; Name=RosBREEDSNP_SNP_CT_1337720_Lg17_00864_MAF40_961431_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
CAAATGTGCTCCTCTGACTTATTGATAGTATCCCC[C/T]GTTAGCTTAC
ACACCAACTTTGAACTGCACAAGGA
Alignments
Feature NameTypeLocationAnalysis
MDC011792.236 contig MDC011792.236:26718..26718. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr17 chromosome Chr17:1615624..1615624+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr09 chromosome Chr09:1317255..1317255+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation