RosBREEDSNP_SNP_AG_3012853_Lg12_01615_MAF30_MDP0000171662_exon3, RosBREEDSNP_SNP_AG_3012853_Lg12_01615_MAF30_MDP0000171662_exon3 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_3012853_Lg12_01615_MAF30_MDP0000171662_exon3
Aliasss475880380
rs267613325
c475880380
SNP_AG_3012853_Lg12_01615_MAF30_MDP0000171662_exon3
AX-105193676
dbSNP IDss475880380
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_3012853_Lg12_01615_MAF30_MDP0000171662_exon3
50K SNP array for apple:RosBREEDSNP_SNP_AG_3012853_Lg12_01615_MAF30_MDP0000171662_exon3
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTCTAAATTTTTCTAGAGACAATCCCCTGGTCATCG
3' Flanking SequenceTTCGGCCACCATCTCTTCGGAGGGTATGTAGTTG
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_AG_3012853_Lg12_01615_MAF30_MDP0000171662_exon3RosBREEDSNP_SNP_AG_3012853_Lg12_01615_MAF30_MDP0000171662_exon3Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_AG_3012853_Lg12_01615_MAF30_MDP0000171662_exon3 ID=RosBREEDSNP_SNP_AG_3012853_Lg12_01615_MAF30_MDP0000171662_exon3|Name=RosBREEDSNP_SNP_AG_3012853_Lg12_01615_MAF30_MDP0000171662_exon3|organism=Malus x domestica|type=genetic_marker|length=70bp
TCTAAATTTTTCTAGAGACAATCCCCTGGTCATCGRTTCGGCCACCATCT
CTTCGGAGGGTATGTAGTTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201312N/A3.01RosBREEDSNP_SNP_AG_3012853_Lg12_01615_MAF30_MDP0000171662_exon3View
2Apple-M432-2013-physical-Malus-domestica12N/A3012853RosBREEDSNP_SNP_AG_3012853_Lg12_01615_MAF30_MDP0000171662_exon3View
Alignments
Feature NameTypeLocationAnalysis
MDC002872.298 contig MDC002872.298:42328..42328. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr12 chromosome Chr12:3117831..3117831. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr12 chromosome Chr12:3117830..3117830. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation