RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1, RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1
Aliasss475877200
rs267610147
c475877200
SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1
AX-105183102
dbSNP IDss475877200
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1
50K SNP array for apple:RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1
TypeSNP
SNP AllelesA/G
5' Flanking SequenceATTTACAGGTTTGTGGAAAGTTTGGAATTTTGTTC
3' Flanking SequenceTATCTAATGGTGACTTGGTCGGTGTTATCCGATT
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1Malus x domesticamarker_locus
RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1-22.022Malus x domesticamarker_locus


The following haplotype_block feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
Mdo-HB-02-29Mdo-HB-02-29Malus x domesticahaplotype_block


The following haplotype feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
2Mdo-HB-02-29_2Malus x domesticahaplotype
3Mdo-HB-02-29_3Malus x domesticahaplotype
4Mdo-HB-02-29_4Malus x domesticahaplotype
5Mdo-HB-02-29_5Malus x domesticahaplotype
6Mdo-HB-02-29_6Malus x domesticahaplotype
7Mdo-HB-02-29_7Malus x domesticahaplotype
8Mdo-HB-02-29_8Malus x domesticahaplotype
9Mdo-HB-02-29_9Malus x domesticahaplotype
10Mdo-HB-02-29_10Malus x domesticahaplotype
11Mdo-HB-02-29_11Malus x domesticahaplotype
12Mdo-HB-02-29_12Malus x domesticahaplotype
13Mdo-HB-02-29_13Malus x domesticahaplotype
14Mdo-HB-02-29_14Malus x domesticahaplotype
15Mdo-HB-02-29_15Malus x domesticahaplotype
16Mdo-HB-02-29_16Malus x domesticahaplotype
17Mdo-HB-02-29_17Malus x domesticahaplotype
18Mdo-HB-02-29_18Malus x domesticahaplotype
19Mdo-HB-02-29_19Malus x domesticahaplotype
20Mdo-HB-02-29_20Malus x domesticahaplotype
21Mdo-HB-02-29_21Malus x domesticahaplotype
22Mdo-HB-02-29_22Malus x domesticahaplotype
23Mdo-HB-02-29_23Malus x domesticahaplotype
24Mdo-HB-02-29_24Malus x domesticahaplotype
25Mdo-HB-02-29_25Malus x domesticahaplotype
26Mdo-HB-02-29_26Malus x domesticahaplotype
27Mdo-HB-02-29_27Malus x domesticahaplotype
28Mdo-HB-02-29_28Malus x domesticahaplotype
29Mdo-HB-02-29_29Malus x domesticahaplotype
30Mdo-HB-02-29_30Malus x domesticahaplotype
31Mdo-HB-02-29_31Malus x domesticahaplotype
32Mdo-HB-02-29_32Malus x domesticahaplotype
33Mdo-HB-02-29_33Malus x domesticahaplotype
34Mdo-HB-02-29_34Malus x domesticahaplotype
35Mdo-HB-02-29_35Malus x domesticahaplotype
36Mdo-HB-02-29_36Malus x domesticahaplotype
37Mdo-HB-02-29_37Malus x domesticahaplotype
38Mdo-HB-02-29_38Malus x domesticahaplotype
39Mdo-HB-02-29_39Malus x domesticahaplotype
40Mdo-HB-02-29_40Malus x domesticahaplotype
41Mdo-HB-02-29_41Malus x domesticahaplotype
42Mdo-HB-02-29_42Malus x domesticahaplotype
43Mdo-HB-02-29_43Malus x domesticahaplotype
44Mdo-HB-02-29_44Malus x domesticahaplotype
45Mdo-HB-02-29_45Malus x domesticahaplotype
46Mdo-HB-02-29_46Malus x domesticahaplotype
47Mdo-HB-02-29_47Malus x domesticahaplotype
48Mdo-HB-02-29_48Malus x domesticahaplotype
49Mdo-HB-02-29_49Malus x domesticahaplotype
50Mdo-HB-02-29_50Malus x domesticahaplotype
51Mdo-HB-02-29_51Malus x domesticahaplotype
52Mdo-HB-02-29_52Malus x domesticahaplotype
53Mdo-HB-02-29_53Malus x domesticahaplotype
54Mdo-HB-02-29_54Malus x domesticahaplotype
55Mdo-HB-02-29_55Malus x domesticahaplotype
56Mdo-HB-02-29_56Malus x domesticahaplotype
57Mdo-HB-02-29_57Malus x domesticahaplotype
58Mdo-HB-02-29_58Malus x domesticahaplotype
59Mdo-HB-02-29_59Malus x domesticahaplotype
60Mdo-HB-02-29_60Malus x domesticahaplotype
61Mdo-HB-02-29_61Malus x domesticahaplotype
62Mdo-HB-02-29_62Malus x domesticahaplotype
63Mdo-HB-02-29_63Malus x domesticahaplotype
64Mdo-HB-02-29_64Malus x domesticahaplotype
65Mdo-HB-02-29_65Malus x domesticahaplotype
66Mdo-HB-02-29_66Malus x domesticahaplotype
67Mdo-HB-02-29_67Malus x domesticahaplotype
68Mdo-HB-02-29_68Malus x domesticahaplotype
69Mdo-HB-02-29_69Malus x domesticahaplotype
70Mdo-HB-02-29_70Malus x domesticahaplotype
71Mdo-HB-02-29_71Malus x domesticahaplotype
72Mdo-HB-02-29_72Malus x domesticahaplotype
73Mdo-HB-02-29_73Malus x domesticahaplotype
74Mdo-HB-02-29_74Malus x domesticahaplotype
75Mdo-HB-02-29_75Malus x domesticahaplotype
76Mdo-HB-02-29_76Malus x domesticahaplotype
77Mdo-HB-02-29_77Malus x domesticahaplotype
78Mdo-HB-02-29_78Malus x domesticahaplotype
79Mdo-HB-02-29_79Malus x domesticahaplotype
80Mdo-HB-02-29_80Malus x domesticahaplotype
81Mdo-HB-02-29_81Malus x domesticahaplotype
82Mdo-HB-02-29_82Malus x domesticahaplotype
83Mdo-HB-02-29_83Malus x domesticahaplotype
84Mdo-HB-02-29_84Malus x domesticahaplotype
85Mdo-HB-02-29_85Malus x domesticahaplotype
86Mdo-HB-02-29_86Malus x domesticahaplotype
87Mdo-HB-02-29_87Malus x domesticahaplotype
88Mdo-HB-02-29_88Malus x domesticahaplotype
89Mdo-HB-02-29_89Malus x domesticahaplotype
90Mdo-HB-02-29_90Malus x domesticahaplotype
91Mdo-HB-02-29_91Malus x domesticahaplotype
92Mdo-HB-02-29_92Malus x domesticahaplotype
93Mdo-HB-02-29_93Malus x domesticahaplotype
94Mdo-HB-02-29_94Malus x domesticahaplotype
95Mdo-HB-02-29_95Malus x domesticahaplotype
96Mdo-HB-02-29_96Malus x domesticahaplotype
97Mdo-HB-02-29_97Malus x domesticahaplotype
98Mdo-HB-02-29_98Malus x domesticahaplotype
99Mdo-HB-02-29_99Malus x domesticahaplotype
100Mdo-HB-02-29_100Malus x domesticahaplotype
101Mdo-HB-02-29_101Malus x domesticahaplotype
102Mdo-HB-02-29_102Malus x domesticahaplotype
103Mdo-HB-02-29_103Malus x domesticahaplotype
104Mdo-HB-02-29_104Malus x domesticahaplotype
105Mdo-HB-02-29_105Malus x domesticahaplotype
106Mdo-HB-02-29_106Malus x domesticahaplotype
107Mdo-HB-02-29_107Malus x domesticahaplotype
108Mdo-HB-02-29_108Malus x domesticahaplotype
109Mdo-HB-02-29_109Malus x domesticahaplotype
110Mdo-HB-02-29_110Malus x domesticahaplotype
111Mdo-HB-02-29_111Malus x domesticahaplotype
112Mdo-HB-02-29_112Malus x domesticahaplotype
113Mdo-HB-02-29_113Malus x domesticahaplotype
114Mdo-HB-02-29_114Malus x domesticahaplotype
115Mdo-HB-02-29_115Malus x domesticahaplotype
116Mdo-HB-02-29_116Malus x domesticahaplotype
117Mdo-HB-02-29_117Malus x domesticahaplotype
118Mdo-HB-02-29_118Malus x domesticahaplotype
119Mdo-HB-02-29_119Malus x domesticahaplotype
120Mdo-HB-02-29_120Malus x domesticahaplotype
121Mdo-HB-02-29_121Malus x domesticahaplotype
122Mdo-HB-02-29_122Malus x domesticahaplotype
123Mdo-HB-02-29_123Malus x domesticahaplotype
124Mdo-HB-02-29_124Malus x domesticahaplotype
125Mdo-HB-02-29_125Malus x domesticahaplotype
126Mdo-HB-02-29_126Malus x domesticahaplotype
127Mdo-HB-02-29_127Malus x domesticahaplotype
128Mdo-HB-02-29_128Malus x domesticahaplotype
129Mdo-HB-02-29_129Malus x domesticahaplotype
130Mdo-HB-02-29_130Malus x domesticahaplotype
131Mdo-HB-02-29_131Malus x domesticahaplotype
132Mdo-HB-02-29_132Malus x domesticahaplotype
133Mdo-HB-02-29_133Malus x domesticahaplotype
134Mdo-HB-02-29_134Malus x domesticahaplotype
135Mdo-HB-02-29_135Malus x domesticahaplotype
136Mdo-HB-02-29_136Malus x domesticahaplotype
137Mdo-HB-02-29_137Malus x domesticahaplotype
138Mdo-HB-02-29_138Malus x domesticahaplotype
139Mdo-HB-02-29_139Malus x domesticahaplotype
140Mdo-HB-02-29_140Malus x domesticahaplotype
141Mdo-HB-02-29_141Malus x domesticahaplotype
142Mdo-HB-02-29_142Malus x domesticahaplotype
143Mdo-HB-02-29_143Malus x domesticahaplotype
144Mdo-HB-02-29_144Malus x domesticahaplotype
145Mdo-HB-02-29_145Malus x domesticahaplotype
146Mdo-HB-02-29_146Malus x domesticahaplotype
147Mdo-HB-02-29_147Malus x domesticahaplotype
148Mdo-HB-02-29_148Malus x domesticahaplotype
149Mdo-HB-02-29_149Malus x domesticahaplotype
150Mdo-HB-02-29_150Malus x domesticahaplotype
151Mdo-HB-02-29_151Malus x domesticahaplotype
152Mdo-HB-02-29_152Malus x domesticahaplotype
153Mdo-HB-02-29_153Malus x domesticahaplotype
154Mdo-HB-02-29_154Malus x domesticahaplotype
155Mdo-HB-02-29_155Malus x domesticahaplotype
156Mdo-HB-02-29_156Malus x domesticahaplotype
157Mdo-HB-02-29_157Malus x domesticahaplotype
158Mdo-HB-02-29_158Malus x domesticahaplotype
159Mdo-HB-02-29_159Malus x domesticahaplotype
160Mdo-HB-02-29_160Malus x domesticahaplotype
161Mdo-HB-02-29_161Malus x domesticahaplotype
162Mdo-HB-02-29_162Malus x domesticahaplotype
163Mdo-HB-02-29_163Malus x domesticahaplotype
164Mdo-HB-02-29_164Malus x domesticahaplotype
165Mdo-HB-02-29_165Malus x domesticahaplotype


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1 ID=RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1|Name=RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1|organism=Malus x domestica|type=genetic_marker|length=70bp
ATTTACAGGTTTGTGGAAAGTTTGGAATTTTGTTCRTATCTAATGGTGAC
TTGGTCGGTGTTATCCGATT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20132N/A21.95RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1View
2Apple-M432-2013-physical-Malus-domestica2N/A12942637RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1View
3Apple-RosBREED-3.9K-20192N/A22.02RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1View
4Apple-Honeycrisp_Consensus-F12N/A22.02RosBREEDSNP_SNP_AG_12942637_Lg2_01552_MAF50_MDP0000683486_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC006631.132 contig MDC006631.132:21046..21046. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr02 chromosome Chr02:11466393..11466393. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr02 chromosome Chr02:11466391..11466391. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation