GDsnp00023, GDsnp00023 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp00023
dbSNP IDss475882493
SNP Array ID
480K SNP array for apple:AX-105214795
IRSC 9K SNP array for apple:GDsnp00023
20K SNP array for apple:GDsnp00023
50K SNP array for apple:AX-105214795
TypeSNP
SNP AllelesT/C
Probe 1GDsnp00023.probe: ACTGAAAATTTTCTCCTTTAAATTAGTACCGTTTAGAAATAGTAGACGCG
5' Flanking SequenceGTATCAAATCATTGAAATTATAACATTTTAATGTACTCATTTCCTATCACACTGAAAATT TTCTCCTTTAAATTAGTACCGTTTAGAAATAGTAGACGCG
3' Flanking SequenceCTAGAGACACAACTTGGCTACTTACATATATTTGTACTCAAATTATTGTGTGATAAATAT GCAAAAGTAGCTCTTGAAAACAACTAAGATAAAGTTCTAC
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2014Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2012Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F114N/A64.83GDsnp00023View
2Apple_HC64_F114N/A56.19GDsnp00023View
3Apple_HCMO_F114N/A1.25GDsnp00023View
4Apple_HGMM_Consenus14N/A74.97GDsnp00023View
5Apple Integrated map14N/A70.4GDsnp00023View
6Pear-PM-F1-PEAR314N/A49.03GDsnp00023View
7Apple-RosBREED-3.9K-201914N/A63.47GDsnp00023View
8Apple-BB-F114N/A59.24GDsnp00023View
9Apple-NC-F114N/A74.08GDsnp00023View
10Apple-NCZFBB-consensus14N/A71.62GDsnp00023View
11Apple-ZF-F114N/A76.5GDsnp00023View
12Apple-Honeycrisp_Consensus-F114N/A63.47GDsnp00023View
13Apple-GDxBr-F1-2013LG14N/A62.47GD_SNP00023View
Sequence
>GDsnp00023 ID=GDsnp00023; Name=GDsnp00023; organism=Malus x domestica; type=genetic_marker; length=75bp
CTTTAAATTAGTACCGTTTAGAAATAGTAGACGCG[C/T]CTAGAGACAC
AACTTGGCTACTTACATATATTTGT