RosBREEDSNP_SNP_AG_30494924_Lg1_250444__250444_exon2, RosBREEDSNP_SNP_AG_30494924_Lg1_250444__250444_exon2 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_30494924_Lg1_250444__250444_exon2
dbSNP IDss475875762
SNP Array ID
480K SNP array for apple:AX-115182282
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_30494924_Lg1_250444__250444_exon2
20K SNP array for apple:RosBREEDSNP_SNP_AG_30494924_Lg1_250444__250444_exon2
50K SNP array for apple:AX-105192594
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_AG_30494924_Lg1_250444__250444_exon2.probe: GAACAAGACTCCCAAGGTGATGCCAATCTTCGTACCAACGACACCATCAA
5' Flanking SequenceAGCGAAAGGAACTGGTGGAGGAGGAGCTGGTGTCATAGCTGTCTGCATGGGAACTGACAC C
3' Flanking SequenceTTGATGGTGTCGTTGGTACGAAGATTGGCATCACCTTGGGAGTCTTGTTCTCCTCGTCTG C
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A13.95SNP_AG_30494924_Lg1_250444__250444_exon2View
2Apple_HC64_F11N/A10.95SNP_AG_30494924_Lg1_250444__250444_exon2View
3Apple_HCMO_F11N/A43.4SNP_AG_30494924_Lg1_250444__250444_exon2View
4Apple_HGMM_Consenus1N/A52.46SNP_AG_30494924_Lg1_250444__250444_exon2View
5Apple-MM-F11N/A49.9b475875762View
6Apple-Honeycrisp_Consensus-F11N/A45.73RosBREEDSNP_SNP_AG_30494924_Lg1_250444__250444_exon2View
Sequence
>RosBREEDSNP_SNP_AG_30494924_Lg1_250444__250444_exon2 ID=RosBREEDSNP_SNP_AG_30494924_Lg1_250444__250444_exon2; Name=RosBREEDSNP_SNP_AG_30494924_Lg1_250444__250444_exon2; organism=Malus x domestica; type=genetic_marker; length=75bp
CTGGTGTCATAGCTGTCTGCATGGGAACTGACACC[A/G]TTGATGGTGT
CGTTGGTACGAAGATTGGCATCACC