RosBREEDSNP_SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1, RosBREEDSNP_SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1
Aliasss475876282
rs267609230
b475876282
SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1
AX-105205043
dbSNP IDss475876282
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1
50K SNP array for apple:RosBREEDSNP_SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1
TypeSNP
SNP AllelesA/G
5' Flanking SequenceGACTATATTTACAGATCGCGTATCACAATTGGCAA
3' Flanking SequenceGGGAAGCAATTTTATACCTTTTCAGTCTTGCTCC
SpeciesMalus x domestica
PolymorphismP_ RosBREEDSNP_SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1RosBREEDSNP_SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1Malus x domesticamarker_locus
RosBREEDSNP_SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1RosBREEDSNP_SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1-46.862Malus x domesticamarker_locus


The following haplotype_block feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
Mdo-HB-11-34Mdo-HB-11-34Malus x domesticahaplotype_block


The following haplotype feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
2Mdo-HB-11-34_2Malus x domesticahaplotype
3Mdo-HB-11-34_3Malus x domesticahaplotype
4Mdo-HB-11-34_4Malus x domesticahaplotype
5Mdo-HB-11-34_5Malus x domesticahaplotype
6Mdo-HB-11-34_6Malus x domesticahaplotype
7Mdo-HB-11-34_7Malus x domesticahaplotype
8Mdo-HB-11-34_8Malus x domesticahaplotype
9Mdo-HB-11-34_9Malus x domesticahaplotype
10Mdo-HB-11-34_10Malus x domesticahaplotype
11Mdo-HB-11-34_11Malus x domesticahaplotype
12Mdo-HB-11-34_12Malus x domesticahaplotype
13Mdo-HB-11-34_13Malus x domesticahaplotype
14Mdo-HB-11-34_14Malus x domesticahaplotype
15Mdo-HB-11-34_15Malus x domesticahaplotype
16Mdo-HB-11-34_16Malus x domesticahaplotype
17Mdo-HB-11-34_17Malus x domesticahaplotype
18Mdo-HB-11-34_18Malus x domesticahaplotype
19Mdo-HB-11-34_19Malus x domesticahaplotype
20Mdo-HB-11-34_20Malus x domesticahaplotype
21Mdo-HB-11-34_21Malus x domesticahaplotype
22Mdo-HB-11-34_22Malus x domesticahaplotype
23Mdo-HB-11-34_23Malus x domesticahaplotype
24Mdo-HB-11-34_24Malus x domesticahaplotype
25Mdo-HB-11-34_25Malus x domesticahaplotype
26Mdo-HB-11-34_26Malus x domesticahaplotype
27Mdo-HB-11-34_27Malus x domesticahaplotype
28Mdo-HB-11-34_28Malus x domesticahaplotype
29Mdo-HB-11-34_29Malus x domesticahaplotype
30Mdo-HB-11-34_30Malus x domesticahaplotype
31Mdo-HB-11-34_31Malus x domesticahaplotype
32Mdo-HB-11-34_32Malus x domesticahaplotype
33Mdo-HB-11-34_33Malus x domesticahaplotype
34Mdo-HB-11-34_34Malus x domesticahaplotype
35Mdo-HB-11-34_35Malus x domesticahaplotype
36Mdo-HB-11-34_36Malus x domesticahaplotype
37Mdo-HB-11-34_37Malus x domesticahaplotype
38Mdo-HB-11-34_38Malus x domesticahaplotype
39Mdo-HB-11-34_39Malus x domesticahaplotype
40Mdo-HB-11-34_40Malus x domesticahaplotype
41Mdo-HB-11-34_41Malus x domesticahaplotype
42Mdo-HB-11-34_42Malus x domesticahaplotype
43Mdo-HB-11-34_43Malus x domesticahaplotype
44Mdo-HB-11-34_44Malus x domesticahaplotype
45Mdo-HB-11-34_45Malus x domesticahaplotype
46Mdo-HB-11-34_46Malus x domesticahaplotype
47Mdo-HB-11-34_47Malus x domesticahaplotype
48Mdo-HB-11-34_48Malus x domesticahaplotype
49Mdo-HB-11-34_49Malus x domesticahaplotype
50Mdo-HB-11-34_50Malus x domesticahaplotype
51Mdo-HB-11-34_51Malus x domesticahaplotype
52Mdo-HB-11-34_52Malus x domesticahaplotype
53Mdo-HB-11-34_53Malus x domesticahaplotype
54Mdo-HB-11-34_54Malus x domesticahaplotype
55Mdo-HB-11-34_55Malus x domesticahaplotype
56Mdo-HB-11-34_56Malus x domesticahaplotype
57Mdo-HB-11-34_57Malus x domesticahaplotype
58Mdo-HB-11-34_58Malus x domesticahaplotype
59Mdo-HB-11-34_59Malus x domesticahaplotype
60Mdo-HB-11-34_60Malus x domesticahaplotype
61Mdo-HB-11-34_61Malus x domesticahaplotype
62Mdo-HB-11-34_62Malus x domesticahaplotype
63Mdo-HB-11-34_63Malus x domesticahaplotype
64Mdo-HB-11-34_64Malus x domesticahaplotype
65Mdo-HB-11-34_65Malus x domesticahaplotype
66Mdo-HB-11-34_66Malus x domesticahaplotype
67Mdo-HB-11-34_67Malus x domesticahaplotype
68Mdo-HB-11-34_68Malus x domesticahaplotype
69Mdo-HB-11-34_69Malus x domesticahaplotype
70Mdo-HB-11-34_70Malus x domesticahaplotype
71Mdo-HB-11-34_71Malus x domesticahaplotype
72Mdo-HB-11-34_72Malus x domesticahaplotype
73Mdo-HB-11-34_73Malus x domesticahaplotype
74Mdo-HB-11-34_74Malus x domesticahaplotype
75Mdo-HB-11-34_75Malus x domesticahaplotype
76Mdo-HB-11-34_76Malus x domesticahaplotype
77Mdo-HB-11-34_77Malus x domesticahaplotype
78Mdo-HB-11-34_78Malus x domesticahaplotype
79Mdo-HB-11-34_79Malus x domesticahaplotype
80Mdo-HB-11-34_80Malus x domesticahaplotype
81Mdo-HB-11-34_81Malus x domesticahaplotype
82Mdo-HB-11-34_82Malus x domesticahaplotype
83Mdo-HB-11-34_83Malus x domesticahaplotype
84Mdo-HB-11-34_84Malus x domesticahaplotype
85Mdo-HB-11-34_85Malus x domesticahaplotype
86Mdo-HB-11-34_86Malus x domesticahaplotype
87Mdo-HB-11-34_87Malus x domesticahaplotype
88Mdo-HB-11-34_88Malus x domesticahaplotype
89Mdo-HB-11-34_89Malus x domesticahaplotype
90Mdo-HB-11-34_90Malus x domesticahaplotype
91Mdo-HB-11-34_91Malus x domesticahaplotype
92Mdo-HB-11-34_92Malus x domesticahaplotype
93Mdo-HB-11-34_93Malus x domesticahaplotype
94Mdo-HB-11-34_94Malus x domesticahaplotype
95Mdo-HB-11-34_95Malus x domesticahaplotype
96Mdo-HB-11-34_96Malus x domesticahaplotype
97Mdo-HB-11-34_97Malus x domesticahaplotype
98Mdo-HB-11-34_98Malus x domesticahaplotype
99Mdo-HB-11-34_99Malus x domesticahaplotype
100Mdo-HB-11-34_100Malus x domesticahaplotype
101Mdo-HB-11-34_101Malus x domesticahaplotype
102Mdo-HB-11-34_102Malus x domesticahaplotype
103Mdo-HB-11-34_103Malus x domesticahaplotype
104Mdo-HB-11-34_104Malus x domesticahaplotype
105Mdo-HB-11-34_105Malus x domesticahaplotype
106Mdo-HB-11-34_106Malus x domesticahaplotype
107Mdo-HB-11-34_107Malus x domesticahaplotype
108Mdo-HB-11-34_108Malus x domesticahaplotype
109Mdo-HB-11-34_109Malus x domesticahaplotype
110Mdo-HB-11-34_110Malus x domesticahaplotype
111Mdo-HB-11-34_111Malus x domesticahaplotype
112Mdo-HB-11-34_112Malus x domesticahaplotype
113Mdo-HB-11-34_113Malus x domesticahaplotype
114Mdo-HB-11-34_114Malus x domesticahaplotype
115Mdo-HB-11-34_115Malus x domesticahaplotype
116Mdo-HB-11-34_116Malus x domesticahaplotype
117Mdo-HB-11-34_117Malus x domesticahaplotype
118Mdo-HB-11-34_118Malus x domesticahaplotype
119Mdo-HB-11-34_119Malus x domesticahaplotype
120Mdo-HB-11-34_120Malus x domesticahaplotype
121Mdo-HB-11-34_121Malus x domesticahaplotype
122Mdo-HB-11-34_122Malus x domesticahaplotype
123Mdo-HB-11-34_123Malus x domesticahaplotype
124Mdo-HB-11-34_124Malus x domesticahaplotype
125Mdo-HB-11-34_125Malus x domesticahaplotype
126Mdo-HB-11-34_126Malus x domesticahaplotype
127Mdo-HB-11-34_127Malus x domesticahaplotype
128Mdo-HB-11-34_128Malus x domesticahaplotype
129Mdo-HB-11-34_129Malus x domesticahaplotype
130Mdo-HB-11-34_130Malus x domesticahaplotype
131Mdo-HB-11-34_131Malus x domesticahaplotype
132Mdo-HB-11-34_132Malus x domesticahaplotype
133Mdo-HB-11-34_133Malus x domesticahaplotype
134Mdo-HB-11-34_134Malus x domesticahaplotype
135Mdo-HB-11-34_135Malus x domesticahaplotype
136Mdo-HB-11-34_136Malus x domesticahaplotype
137Mdo-HB-11-34_137Malus x domesticahaplotype
138Mdo-HB-11-34_138Malus x domesticahaplotype
139Mdo-HB-11-34_139Malus x domesticahaplotype
140Mdo-HB-11-34_140Malus x domesticahaplotype
141Mdo-HB-11-34_141Malus x domesticahaplotype
142Mdo-HB-11-34_142Malus x domesticahaplotype
143Mdo-HB-11-34_143Malus x domesticahaplotype
144Mdo-HB-11-34_144Malus x domesticahaplotype
145Mdo-HB-11-34_145Malus x domesticahaplotype
146Mdo-HB-11-34_146Malus x domesticahaplotype
147Mdo-HB-11-34_147Malus x domesticahaplotype
148Mdo-HB-11-34_148Malus x domesticahaplotype
149Mdo-HB-11-34_149Malus x domesticahaplotype
150Mdo-HB-11-34_150Malus x domesticahaplotype
151Mdo-HB-11-34_151Malus x domesticahaplotype
152Mdo-HB-11-34_152Malus x domesticahaplotype
153Mdo-HB-11-34_153Malus x domesticahaplotype
154Mdo-HB-11-34_154Malus x domesticahaplotype
155Mdo-HB-11-34_155Malus x domesticahaplotype
156Mdo-HB-11-34_156Malus x domesticahaplotype
157Mdo-HB-11-34_157Malus x domesticahaplotype
158Mdo-HB-11-34_158Malus x domesticahaplotype
159Mdo-HB-11-34_159Malus x domesticahaplotype
160Mdo-HB-11-34_160Malus x domesticahaplotype
161Mdo-HB-11-34_161Malus x domesticahaplotype
162Mdo-HB-11-34_162Malus x domesticahaplotype
163Mdo-HB-11-34_163Malus x domesticahaplotype
164Mdo-HB-11-34_164Malus x domesticahaplotype
165Mdo-HB-11-34_165Malus x domesticahaplotype


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1 ID=RosBREEDSNP_SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1|Name=RosBREEDSNP_SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1|organism=Malus x domestica|type=genetic_marker|length=70bp
GACTATATTTACAGATCGCGTATCACAATTGGCAARGGGAAGCAATTTTA
TACCTTTTCAGTCTTGCTCC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HC64_F111N/A57.49SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1View
2Apple_HGMM_Consenus11N/A74.8SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1View
3Apple-M432-201311N/A53.9SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1View
4Apple-M432-2013-physical-Malus-domestica11N/A26508831SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1View
5Apple-RosBREED-3.9K-201911N/A46.86SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1View
6Apple-BB-F111N/A43.74SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1View
7Apple-NC-F111N/A61.21SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1View
8Apple-NCZFBB-consensus11N/A46.89SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1View
9Apple-ZF-F111N/A63.91SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1View
10Apple-Honeycrisp_Consensus-F111N/A46.86RosBREEDSNP_SNP_AG_26508831_Lg11_138333_MAF20_138333_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC011766.689 contig MDC011766.689:7087..7087. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr11 chromosome Chr11:31389951..31389951. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr11 chromosome Chr11:31389950..31389950. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation