RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1, RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1
Aliasa475876322
rs267609270
ss475876322
dbSNP IDss475876322
SNP Array ID
20K SNP array for apple:RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1
480K SNP array for apple:RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1.probe: TAATGGAGCATTCCCAGATTCACAGTCACCATTTTTCAGAGAAACCCAGA
5' Flanking SequenceGGTCCAGAACATAATGGAGCATTCCCAGATTCACAGTCACCATTTTTCAGAGAAACCCAG A
3' Flanking SequenceATTTAAACACCAAAATTTTTACAAAAAATGGTTTCTTTCGATCAATTTAAACAAAACCGA G
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
480K SNP array for appleSNP_chip
20K SNP array for appleSNP_chip
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeRosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1.probeMalus x domesticaprobe


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1Malus x domesticamarker_locus
RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1-27.92Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1 ID=RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1|Name=RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1|organism=Malus x domestica|type=genetic_marker|length=75bp
AGATTCACAGTCACCATTTTTCAGAGAAACCCAGA[A/G]ATTTAAACAC
CAAAATTTTTACAAAAAATGGTTTC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201312N/A13.24RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1View
2Apple-M432-2013-physical-Malus-domestica12N/A7044670RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1View
3Pear-PH-CG-2017LG14N/A27.92RosBREEDSNP_SNP_AG_7044670_Lg12_159023_MAF40_159023_exon1-27.92View
Alignments
Feature NameTypeLocationAnalysis
MDC007432.378 contig MDC007432.378:2180..2180. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr12 chromosome Chr12:7303376..7303376+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218