GDsnp01789, GDsnp01789 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp01789
Aliasss475882295
rs267615240
GD_01789_L10_PA
dbSNP IDss475882295
SNP Array ID
480K SNP array for apple:AX-115183903
IRSC 9K SNP array for apple:GDsnp01789
20K SNP array for apple:GDsnp01789
TypeSNP
SNP AllelesA/G
Probe 1GDsnp01789.probe: CCTGCATTACAACAAACAAAATCAGCCGAAAACACTACTACAGTATCGCC
5' Flanking SequenceTCCGTTCCTCCAGGGAAAGAGTGAATGAAGATCTTCTTATAAATAAACTAAAACCGACTT ACAATAGGCATGTTAATGCCTGCTGATACCAAAAAGGATA
3' Flanking SequenceGGCGATACTGTAGTAGTGTTTTCGGCTGATTTTGTTTGTTGTAATGCAGGTAATGCGATT TTTTACGAACCCTCACAAGCCCACTATACTTGCATTGTCT
SpeciesMalus x domestica
PolymorphismP_ GDsnp01789
Publication[view all]
ContactMichela Troggio
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2014Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2011Micheletti D, Troggio M, Zharkikh A, Costa F, Malnoy M, Velasco R, Salvi S. Genetic diversity of the genus Malus and implications for linkage mapping with SNPs. Tree Genetics & Genomes. 2011; 7(4):857-868.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp01789GDsnp01789Malus x domesticamarker_locus
GD_SNP01789GD_SNP01789Malus x domesticamarker_locus


The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeGDsnp01789.probeMalus x domesticaprobe


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>GDsnp01789 ID=GDsnp01789|Name=GDsnp01789|organism=Malus x domestica|type=genetic_marker|length=75bp
AGGCATGTTAATGCCTGCTGATACCAAAAAGGATA[C/T]GGCGATACTG
TAGTAGTGTTTTCGGCTGATTTTGT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map10N/A0.9GDsnp01789View
2Apple_HCGA_F110N/A63.71GDsnp01789View
3Apple_HC64_F110N/A90.56GDsnp01789View
4Apple_HCMO_F110N/A0GDsnp01789View
5Apple_HGMM_Consenus10N/A0GDsnp01789View
6Apple-RGTxGD-F1-2015GD_10N/A0GDsnp01789View
7Apple-B-F1-2014B10N/A0GDsnp01789View
8Apple-Honeycrisp_Consensus-F110N/A0GDsnp01789View
9Apple-FjxPL-F1-2013LG10N/A0GDsnp01789View
10Apple-GB-F1LG_10N/A0GD_SNP01789View
11Apple-GDxBr-F1-2013LG10N/A0GD_SNP01789View
Alignments
Feature NameTypeLocationAnalysis
MDC010427.133 contig MDC010427.133:8394..8394. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr10 chromosome Chr10:557767..557767+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr10 chromosome Chr10:557717..557817+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218