RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1, RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1
dbSNP IDss475877203
SNP Array ID
480K SNP array for apple:AX-115182437
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1
20K SNP array for apple:RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1
50K SNP array for apple:AX-105210546
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1.probe: CAGGATGTGTCATTGCACCAGAAAGCTGGAGATATGGAGAAGCTCAATGG
5' Flanking SequenceCCTCTGCGTTGTTGACATCCCCATTGAGCTTCACCCCCTTGGCCTCAGCGTCGTTGACAT C
3' Flanking SequenceCCATTGAGCTTCTCCATATCTCCAGCTTTCTGGTGCAATGACACATCCTGCTCCGAGTAA C
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Associated WithGWAS0001258
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F12N/A31.1b475877203View
2Apple-Honeycrisp_Consensus-F12N/A22.3RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1View
3Apple-RosBREED-3.9K-20192N/A22.3RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1View
4Apple-BB-F12N/A34.33RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1View
5Apple-NC-F12N/A27.21RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1View
6Apple-NCZFBB-consensus2N/A29.2RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1View
7Apple-ZF-F12N/A20.7RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1View
Sequence
>RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1 ID=RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1; Name=RosBREEDSNP_SNP_CT_13646169_Lg2_00214_MAF50_1635069_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
AGCTTCACCCCCTTGGCCTCAGCGTCGTTGACATC[C/T]CCATTGAGCT
TCTCCATATCTCCAGCTTTCTGGTG
Alignments
Feature NameTypeLocationAnalysis
MDC020353.84 contig MDC020353.84:3354..3354. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr02 chromosome Chr02:11944337..11944337- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Annotated Terms
The following terms have been associated with this genetic_marker:
Vocabulary: Rosaceae Trait Ontology
TermDefinition
MAIN:000201210chlorogenic acid content
MAIN:000201216unknown procyanidin oligomer 1 content