RosBREEDSNP_SNP_TG_13072327_Lg4_13652_MAF10_13652_exon1, RosBREEDSNP_SNP_TG_13072327_Lg4_13652_MAF10_13652_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_TG_13072327_Lg4_13652_MAF10_13652_exon1
dbSNP IDss475875925
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_TG_13072327_Lg4_13652_MAF10_13652_exon1
50K SNP array for apple:AX-105217375
TypeSNP
SNP AllelesT/G
5' Flanking SequenceTCTACCTCGTTTATCAACGAAGGATTTGCCTTCGC
3' Flanking SequenceAGCTCATCCACCAATTCGACATTCAGTCCCTTGA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201314N/A24.24RosBREEDSNP_SNP_TG_13072327_Lg4_13652_MAF10_13652_exon1View
2Apple-M432-2013-physical-Malus-domestica4N/A13072327RosBREEDSNP_SNP_TG_13072327_Lg4_13652_MAF10_13652_exon1View
Sequence
>RosBREEDSNP_SNP_TG_13072327_Lg4_13652_MAF10_13652_exon1 ID=RosBREEDSNP_SNP_TG_13072327_Lg4_13652_MAF10_13652_exon1; Name=RosBREEDSNP_SNP_TG_13072327_Lg4_13652_MAF10_13652_exon1; organism=Malus x domestica; type=genetic_marker; length=70bp
TCTACCTCGTTTATCAACGAAGGATTTGCCTTCGCKAGCTCATCCACCAA
TTCGACATTCAGTCCCTTGA
Alignments
Feature NameTypeLocationAnalysis
MDC013050.349 contig MDC013050.349:4296..4296. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr04 chromosome Chr04:20261171..20261171. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation