RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1, RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1
Aliasss475877044
rs267609991
c475877044
SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1
AX-105194025
dbSNP IDss475877044
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1
50K SNP array for apple:RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1
TypeSNP
SNP AllelesT/C
5' Flanking SequenceCGTCGAAATCCAGTTCAGAAACTTCATCTCCATCT
3' Flanking SequenceGTCCTTCCTCGATCTCCAGAATCCATGGTATGCA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1Malus x domesticamarker_locus
RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1-60.34Malus x domesticamarker_locus
RosBREED_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1RosBREED_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1 ID=RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1|Name=RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1|organism=Malus x domestica|type=genetic_marker|length=70bp
CGTCGAAATCCAGTTCAGAAACTTCATCTCCATCTYGTCCTTCCTCGATC
TCCAGAATCCATGGTATGCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20132N/A9.8RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1View
2Apple-M432-2013-physical-Malus-domestica2N/A4326366RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1View
3Pear-PH-CG-2017LG2N/A60.34RosBREEDSNP_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1View
4Pear-PM-F1-Moonglow2N/A5.34RosBREED_SNP_CT_4326366_Lg2_01945_MAF50_1633451_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC006388.284 contig MDC006388.284:6396..6396. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr02 chromosome Chr02:3774204..3774204. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr02 chromosome Chr02:3774203..3774203. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation