RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1, RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1
Aliasb475880962
rs267613907
ss475880962
dbSNP IDss475880962
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1
480K SNP array for apple:RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1
TypeSNP
SNP AllelesM
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
480K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1Malus x domesticamarker_locus
RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1-1Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1 ID=RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1|Name=RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1|organism=Malus x domestica|type=genetic_marker|length=75bp
GCAGTAGCTATGCCACTACTTTGGATTAATGACCA[A/C]GGCGAAGGGC
ATGAAGGTTATTATCTAGTTCCAAC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201312N/A0.12RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1View
2Apple-M432-2013-physical-Malus-domestica14N/A195425RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1View
3Pear-PH-CG-2017LG14N/A1RosBREEDSNP_SNP_CA_195425_Lg14_01888_MAF20_1660271_exon1-1View
Alignments
Feature NameTypeLocationAnalysis
MDC018367.266 contig MDC018367.266:3118..3118. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr14 chromosome Chr14:361071..361071+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation