RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2, RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2
Aliasc475876325
rs267609273
ss475876325
dbSNP IDss475876325
SNP Array ID
20K SNP array for apple:RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2
480K SNP array for apple:RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2.probe: TATTATGATGATCGTGGCCCTCCATATTTCTAGACCCCATTTGATGAGTT
5' Flanking SequenceACTGTGCACCCTATTATGATGATCGTGGCCCTCCATATTTCTAGACCCCATTTGATGAGT T
3' Flanking SequenceCTCCAAGATTCAAATACACCAATCTAGAATCCAAGTTAAGATTCCCAATGTTGCTGCCAC T
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
480K SNP array for appleSNP_chip
20K SNP array for appleSNP_chip
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeRosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2.probeMalus x domesticaprobe


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2Malus x domesticamarker_locus
RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2-25.58Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2 ID=RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2|Name=RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2|organism=Malus x domestica|type=genetic_marker|length=75bp
GGCCCTCCATATTTCTAGACCCCATTTGATGAGTT[A/G]CTCCAAGATT
CAAATACACCAATCTAGAATCCAAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201312N/A19.86RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2View
2Apple-M432-2013-physical-Malus-domestica12N/A12543650RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2View
3Pear-PH-CG-2017LG12N/A25.58RosBREEDSNP_SNP_GA_12543650_Lg12_MDP0000210506_MAF20_MDP0000210506_exon2-25.58View
Alignments
Feature NameTypeLocationAnalysis
MDC004551.509 contig MDC004551.509:4766..4766. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr12 chromosome Chr12:11524775..11524775- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218