RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1, RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1
Aliasss475876685
rs267609632
a475876685
SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1
AX-105192222
dbSNP IDss475876685
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1
50K SNP array for apple:RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1
TypeSNP
SNP AllelesT/C
5' Flanking SequenceACCGCACTCAACTTCCAATACCTCCACACAACGAT
3' Flanking SequenceGCCTCCAACTCAAGCTCTCAATCTGACTCCAACA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1Malus x domesticamarker_locus


The following haplotype_block feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
Mdo-HB-04-4Mdo-HB-04-4Malus x domesticahaplotype_block


The following haplotype feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
2Mdo-HB-04-4_2Malus x domesticahaplotype
3Mdo-HB-04-4_3Malus x domesticahaplotype
4Mdo-HB-04-4_4Malus x domesticahaplotype
5Mdo-HB-04-4_5Malus x domesticahaplotype
6Mdo-HB-04-4_6Malus x domesticahaplotype
7Mdo-HB-04-4_7Malus x domesticahaplotype
8Mdo-HB-04-4_8Malus x domesticahaplotype
9Mdo-HB-04-4_9Malus x domesticahaplotype
10Mdo-HB-04-4_10Malus x domesticahaplotype
11Mdo-HB-04-4_11Malus x domesticahaplotype
12Mdo-HB-04-4_12Malus x domesticahaplotype
13Mdo-HB-04-4_13Malus x domesticahaplotype
14Mdo-HB-04-4_14Malus x domesticahaplotype
15Mdo-HB-04-4_15Malus x domesticahaplotype
16Mdo-HB-04-4_16Malus x domesticahaplotype
17Mdo-HB-04-4_17Malus x domesticahaplotype
18Mdo-HB-04-4_18Malus x domesticahaplotype
19Mdo-HB-04-4_19Malus x domesticahaplotype
20Mdo-HB-04-4_20Malus x domesticahaplotype
21Mdo-HB-04-4_21Malus x domesticahaplotype
22Mdo-HB-04-4_22Malus x domesticahaplotype
23Mdo-HB-04-4_23Malus x domesticahaplotype
24Mdo-HB-04-4_24Malus x domesticahaplotype
25Mdo-HB-04-4_25Malus x domesticahaplotype
26Mdo-HB-04-4_26Malus x domesticahaplotype
27Mdo-HB-04-4_27Malus x domesticahaplotype
28Mdo-HB-04-4_28Malus x domesticahaplotype
29Mdo-HB-04-4_29Malus x domesticahaplotype
30Mdo-HB-04-4_30Malus x domesticahaplotype
31Mdo-HB-04-4_31Malus x domesticahaplotype
32Mdo-HB-04-4_32Malus x domesticahaplotype
33Mdo-HB-04-4_33Malus x domesticahaplotype
34Mdo-HB-04-4_34Malus x domesticahaplotype
35Mdo-HB-04-4_35Malus x domesticahaplotype
36Mdo-HB-04-4_36Malus x domesticahaplotype
37Mdo-HB-04-4_37Malus x domesticahaplotype
38Mdo-HB-04-4_38Malus x domesticahaplotype
39Mdo-HB-04-4_39Malus x domesticahaplotype
40Mdo-HB-04-4_40Malus x domesticahaplotype
41Mdo-HB-04-4_41Malus x domesticahaplotype
42Mdo-HB-04-4_42Malus x domesticahaplotype
43Mdo-HB-04-4_43Malus x domesticahaplotype
44Mdo-HB-04-4_44Malus x domesticahaplotype
45Mdo-HB-04-4_45Malus x domesticahaplotype
46Mdo-HB-04-4_46Malus x domesticahaplotype
47Mdo-HB-04-4_47Malus x domesticahaplotype
48Mdo-HB-04-4_48Malus x domesticahaplotype
49Mdo-HB-04-4_49Malus x domesticahaplotype
50Mdo-HB-04-4_50Malus x domesticahaplotype
51Mdo-HB-04-4_51Malus x domesticahaplotype
52Mdo-HB-04-4_52Malus x domesticahaplotype
53Mdo-HB-04-4_53Malus x domesticahaplotype
54Mdo-HB-04-4_54Malus x domesticahaplotype
55Mdo-HB-04-4_55Malus x domesticahaplotype
56Mdo-HB-04-4_56Malus x domesticahaplotype
57Mdo-HB-04-4_57Malus x domesticahaplotype
58Mdo-HB-04-4_58Malus x domesticahaplotype
59Mdo-HB-04-4_59Malus x domesticahaplotype
60Mdo-HB-04-4_60Malus x domesticahaplotype
61Mdo-HB-04-4_61Malus x domesticahaplotype
62Mdo-HB-04-4_62Malus x domesticahaplotype
63Mdo-HB-04-4_63Malus x domesticahaplotype
64Mdo-HB-04-4_64Malus x domesticahaplotype
65Mdo-HB-04-4_65Malus x domesticahaplotype
66Mdo-HB-04-4_66Malus x domesticahaplotype
67Mdo-HB-04-4_67Malus x domesticahaplotype
68Mdo-HB-04-4_68Malus x domesticahaplotype
69Mdo-HB-04-4_69Malus x domesticahaplotype
70Mdo-HB-04-4_70Malus x domesticahaplotype
71Mdo-HB-04-4_71Malus x domesticahaplotype
72Mdo-HB-04-4_72Malus x domesticahaplotype
73Mdo-HB-04-4_73Malus x domesticahaplotype
74Mdo-HB-04-4_74Malus x domesticahaplotype
75Mdo-HB-04-4_75Malus x domesticahaplotype
76Mdo-HB-04-4_76Malus x domesticahaplotype
77Mdo-HB-04-4_77Malus x domesticahaplotype
78Mdo-HB-04-4_78Malus x domesticahaplotype
79Mdo-HB-04-4_79Malus x domesticahaplotype
80Mdo-HB-04-4_80Malus x domesticahaplotype
81Mdo-HB-04-4_81Malus x domesticahaplotype
82Mdo-HB-04-4_82Malus x domesticahaplotype
83Mdo-HB-04-4_83Malus x domesticahaplotype
84Mdo-HB-04-4_84Malus x domesticahaplotype
85Mdo-HB-04-4_85Malus x domesticahaplotype
86Mdo-HB-04-4_86Malus x domesticahaplotype
87Mdo-HB-04-4_87Malus x domesticahaplotype
88Mdo-HB-04-4_88Malus x domesticahaplotype
89Mdo-HB-04-4_89Malus x domesticahaplotype
90Mdo-HB-04-4_90Malus x domesticahaplotype
91Mdo-HB-04-4_91Malus x domesticahaplotype
92Mdo-HB-04-4_92Malus x domesticahaplotype
93Mdo-HB-04-4_93Malus x domesticahaplotype
94Mdo-HB-04-4_94Malus x domesticahaplotype
95Mdo-HB-04-4_95Malus x domesticahaplotype
96Mdo-HB-04-4_96Malus x domesticahaplotype
97Mdo-HB-04-4_97Malus x domesticahaplotype
98Mdo-HB-04-4_98Malus x domesticahaplotype
99Mdo-HB-04-4_99Malus x domesticahaplotype
100Mdo-HB-04-4_100Malus x domesticahaplotype
101Mdo-HB-04-4_101Malus x domesticahaplotype
102Mdo-HB-04-4_102Malus x domesticahaplotype
103Mdo-HB-04-4_103Malus x domesticahaplotype
104Mdo-HB-04-4_104Malus x domesticahaplotype
105Mdo-HB-04-4_105Malus x domesticahaplotype
106Mdo-HB-04-4_106Malus x domesticahaplotype
107Mdo-HB-04-4_107Malus x domesticahaplotype
108Mdo-HB-04-4_108Malus x domesticahaplotype
109Mdo-HB-04-4_109Malus x domesticahaplotype
110Mdo-HB-04-4_110Malus x domesticahaplotype
111Mdo-HB-04-4_111Malus x domesticahaplotype
112Mdo-HB-04-4_112Malus x domesticahaplotype
113Mdo-HB-04-4_113Malus x domesticahaplotype
114Mdo-HB-04-4_114Malus x domesticahaplotype
115Mdo-HB-04-4_115Malus x domesticahaplotype
116Mdo-HB-04-4_116Malus x domesticahaplotype
117Mdo-HB-04-4_117Malus x domesticahaplotype
118Mdo-HB-04-4_118Malus x domesticahaplotype
119Mdo-HB-04-4_119Malus x domesticahaplotype
120Mdo-HB-04-4_120Malus x domesticahaplotype
121Mdo-HB-04-4_121Malus x domesticahaplotype
122Mdo-HB-04-4_122Malus x domesticahaplotype
123Mdo-HB-04-4_123Malus x domesticahaplotype
124Mdo-HB-04-4_124Malus x domesticahaplotype
125Mdo-HB-04-4_125Malus x domesticahaplotype
126Mdo-HB-04-4_126Malus x domesticahaplotype
127Mdo-HB-04-4_127Malus x domesticahaplotype
128Mdo-HB-04-4_128Malus x domesticahaplotype
129Mdo-HB-04-4_129Malus x domesticahaplotype
130Mdo-HB-04-4_130Malus x domesticahaplotype
131Mdo-HB-04-4_131Malus x domesticahaplotype
132Mdo-HB-04-4_132Malus x domesticahaplotype
133Mdo-HB-04-4_133Malus x domesticahaplotype
134Mdo-HB-04-4_134Malus x domesticahaplotype
135Mdo-HB-04-4_135Malus x domesticahaplotype
136Mdo-HB-04-4_136Malus x domesticahaplotype
137Mdo-HB-04-4_137Malus x domesticahaplotype
138Mdo-HB-04-4_138Malus x domesticahaplotype
139Mdo-HB-04-4_139Malus x domesticahaplotype
140Mdo-HB-04-4_140Malus x domesticahaplotype
141Mdo-HB-04-4_141Malus x domesticahaplotype
142Mdo-HB-04-4_142Malus x domesticahaplotype
143Mdo-HB-04-4_143Malus x domesticahaplotype
144Mdo-HB-04-4_144Malus x domesticahaplotype
145Mdo-HB-04-4_145Malus x domesticahaplotype
146Mdo-HB-04-4_146Malus x domesticahaplotype
147Mdo-HB-04-4_147Malus x domesticahaplotype
148Mdo-HB-04-4_148Malus x domesticahaplotype
149Mdo-HB-04-4_149Malus x domesticahaplotype
150Mdo-HB-04-4_150Malus x domesticahaplotype
151Mdo-HB-04-4_151Malus x domesticahaplotype
152Mdo-HB-04-4_152Malus x domesticahaplotype
153Mdo-HB-04-4_153Malus x domesticahaplotype
154Mdo-HB-04-4_154Malus x domesticahaplotype
155Mdo-HB-04-4_155Malus x domesticahaplotype
156Mdo-HB-04-4_156Malus x domesticahaplotype
157Mdo-HB-04-4_157Malus x domesticahaplotype
158Mdo-HB-04-4_158Malus x domesticahaplotype
159Mdo-HB-04-4_159Malus x domesticahaplotype
160Mdo-HB-04-4_160Malus x domesticahaplotype
161Mdo-HB-04-4_161Malus x domesticahaplotype
162Mdo-HB-04-4_162Malus x domesticahaplotype
163Mdo-HB-04-4_163Malus x domesticahaplotype
164Mdo-HB-04-4_164Malus x domesticahaplotype
165Mdo-HB-04-4_165Malus x domesticahaplotype


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1 ID=RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1|Name=RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1|organism=Malus x domestica|type=genetic_marker|length=70bp
ACCGCACTCAACTTCCAATACCTCCACACAACGATYGCCTCCAACTCAAG
CTCTCAATCTGACTCCAACA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20134N/A7.5RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1View
2Apple-M432-2013-physical-Malus-domestica1N/A9976748RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1View
3Apple-RosBREED-3.9K-20194N/A6.78RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1View
4Apple-BB-F14N/A8.07RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1View
5Apple-NC-F14N/A11.64RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1View
6Apple-NCZFBB-consensus4N/A6.12RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1View
7Apple-ZF-F14N/A3.45RosBREEDSNP_SNP_CT_9976748_Lg1_RosCOS404_MAF30_MDP0000188908_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC010934.232 contig MDC010934.232:7588..7588. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr04 chromosome Chr04:3296637..3296637. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr04 chromosome Chr04:3296636..3296636. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation