RosBREEDSNP_SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2, RosBREEDSNP_SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2
dbSNP IDss475876885
SNP Array ID
480K SNP array for apple:AX-105217416
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2
20K SNP array for apple:RosBREEDSNP_SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2
50K SNP array for apple:AX-105217416
TypeSNP
SNP AllelesA/C
Probe 1RosBREEDSNP_SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2.probe: CTGGGATAAGCAACCTTGTCAACTTGCAGTTATTAAGTTTTGGGTTGAAC
5' Flanking SequenceGAACATCCCAGCTGGGATAAGCAACCTTGTCAACTTGCAGTTATTAAGTTTTGGGTTGAA C
3' Flanking SequenceACTTCACAGGTAACATCCCTACAGGCATTGGAAAGCTTACAAGGATTGACCAATTAATTT T
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
MDC005535.334contigMDC005535.334:6760..6760 .Malus x domestica Whole Genome v1.0 Assembly & Annotationn/a
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A14.76SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2View
2Apple_HC64_F11N/A11.85SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2View
3Apple_HCMO_F11N/A43.4SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2View
4Apple_HGMM_Consenus1N/A51.6SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2View
5apple-RGxGS-F1-2015LG1N/A44.6SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2View
6Apple-RosBREED-3.9K-20191N/A44.37SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2View
7Apple-consensus-Allard-2016LG1N/A51.05SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2View
8Apple-MM-F11N/A49.9b475876885View
9apple-RosBREED-sweetness-2015LG1N/A67.6ss475876885View
10Apple-Honeycrisp_Consensus-F11N/A44.37RosBREEDSNP_SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2View
Sequence
>RosBREEDSNP_SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2 ID=RosBREEDSNP_SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2; Name=RosBREEDSNP_SNP_AC_30246914_Lg1_CXE4_MAF50_MDP0000473154_exon2; organism=Malus x domestica; type=genetic_marker; length=75bp
TTGTCAACTTGCAGTTATTAAGTTTTGGGTTGAAC[A/C]ACTTCACAGG
TAACATCCCTACAGGCATTGGAAAG