RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4, RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4
Aliasss475879165
rs267612111
a475879165
SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4
AX-105196756
dbSNP IDss475879165
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4
50K SNP array for apple:RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTAGATTTATCTTCAACGTCATCTGAGAACTCGTCC
3' Flanking SequenceCAGATTGGTGACCAGAACTATCCACCGAGGGCCC
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4Malus x domesticamarker_locus
RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4-35.112Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4 ID=RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4|Name=RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4|organism=Malus x domestica|type=genetic_marker|length=70bp
TAGATTTATCTTCAACGTCATCTGAGAACTCGTCCRCAGATTGGTGACCA
GAACTATCCACCGAGGGCCC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20138N/A41.06RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4View
2Apple-M432-2013-physical-Malus-domestica8N/A25196746RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4View
3Apple-Honeycrisp_Consensus-F18N/A35.11RosBREEDSNP_SNP_GA_25196746_Lg8_01598_MAF50_526504_exon4View
Alignments
Feature NameTypeLocationAnalysis
MDC000805.390 contig MDC000805.390:21236..21236. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr08 chromosome Chr08:18462408..18462408. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr08 chromosome Chr08:18462407..18462407. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation