RosBREEDSNP_SNP_GA_11372671_Lg14_02214_MAF20_MDP0000286281_exon6, RosBREEDSNP_SNP_GA_11372671_Lg14_02214_MAF20_MDP0000286281_exon6 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_11372671_Lg14_02214_MAF20_MDP0000286281_exon6
Aliasss475881043
rs267613988
b475881043
SNP_GA_11372671_Lg14_02214_MAF20_MDP0000286281_exon6
AX-105191874
dbSNP IDss475881043
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_11372671_Lg14_02214_MAF20_MDP0000286281_exon6
50K SNP array for apple:RosBREEDSNP_SNP_GA_11372671_Lg14_02214_MAF20_MDP0000286281_exon6
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTGCCAAATCGGGTCTTGTAAATCTAAGATATTGTA
3' Flanking SequenceTGCTCCTACCAAACTCTGATATAAAGTAGGATCA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_GA_11372671_Lg14_02214_MAF20_MDP0000286281_exon6RosBREEDSNP_SNP_GA_11372671_Lg14_02214_MAF20_MDP0000286281_exon6Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_GA_11372671_Lg14_02214_MAF20_MDP0000286281_exon6 ID=RosBREEDSNP_SNP_GA_11372671_Lg14_02214_MAF20_MDP0000286281_exon6|Name=RosBREEDSNP_SNP_GA_11372671_Lg14_02214_MAF20_MDP0000286281_exon6|organism=Malus x domestica|type=genetic_marker|length=70bp
TGCCAAATCGGGTCTTGTAAATCTAAGATATTGTARTGCTCCTACCAAAC
TCTGATATAAAGTAGGATCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201311N/A57.4RosBREEDSNP_SNP_GA_11372671_Lg14_02214_MAF20_MDP0000286281_exon6View
2Apple-M432-2013-physical-Malus-domestica14N/A11372671RosBREEDSNP_SNP_GA_11372671_Lg14_02214_MAF20_MDP0000286281_exon6View
Alignments
Feature NameTypeLocationAnalysis
MDC008931.613 contig MDC008931.613:8501..8501. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr11 chromosome Chr11:34160811..34160811. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr11 chromosome Chr11:34160809..34160809. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation