GDsnp02894, GDsnp02894 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp02894
dbSNP IDss475882258
SNP Array ID
IRSC 9K SNP array for apple:GDsnp02894
50K SNP array for apple:AX-105205457
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTGACCTATTCAAAGGACAAGGAGGGATTGCTCTGT
3' Flanking SequenceTGAAGAAGTCCATCTGGCGGCCCAAAGAGTCGGA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
MDC005454.165contigMDC005454.165:3202..3202 .Malus x domestica Whole Genome v1.0 Assembly & Annotationn/a
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map1N/A1.5GDsnp02894View
2Apple-Honeycrisp_Consensus-F11N/A0GDsnp02894View
3Apple-RosBREED-3.9K-20191N/A0GDsnp02894View
4Apple-GDxBr-F1-2013LG1N/A0GD_SNP02894View
Sequence
>GDsnp02894 ID=GDsnp02894; Name=GDsnp02894; organism=Malus x domestica; type=genetic_marker; length=70bp
TGACCTATTCAAAGGACAAGGAGGGATTGCTCTGTRTGAAGAAGTCCATC
TGGCGGCCCAAAGAGTCGGA