RosBREEDSNP_SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1, RosBREEDSNP_SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1
dbSNP IDss475882949
SNP Array ID
480K SNP array for apple:AX-115182547
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1
20K SNP array for apple:RosBREEDSNP_SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1
50K SNP array for apple:AX-105210718
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1.probe: CCAGGTCCTCTGAAGCAGCTTCAAAAATTTTGGGTAAATGGTATCGATCG
5' Flanking SequenceAGATTTATACATGTTCTTTATTATTCAAAATTGTTCATGTTTGTCATAACAAAATACAAG C
3' Flanking SequenceCGATCGATACCATTTACCCAAAATTTTTGAAGCTGCTTCAGAGGACCTGGAAAACACAAA G
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F12N/A8.23SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1View
2Apple_HC64_F12N/A9.28SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1View
3Apple_HCMO_F12N/A4.99SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1View
4Apple_HGMM_Consenus2N/A10.72SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1View
5apple-RGxGS-F1-2015LG2N/A19SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1View
6Apple-RGTxGD-F1-2015GD_2N/A23.6SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1View
7Apple-RosBREED-3.9K-20192N/A14.97SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1View
8Apple-consensus-Allard-2016LG2N/A22.06SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1View
9Apple-MM-F12N/A22c475882949View
10Apple-Honeycrisp_Consensus-F12N/A14.97RosBREEDSNP_SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1View
Sequence
>RosBREEDSNP_SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1 ID=RosBREEDSNP_SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1; Name=RosBREEDSNP_SNP_CT_7255188_Lg2_00505_MAF50_571945_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
AAAATTGTTCATGTTTGTCATAACAAAATACAAGC[C/T]CGATCGATAC
CATTTACCCAAAATTTTTGAAGCTG