AFL2, AFL2 (genetic_marker) Malus x domestica

Marker Overview
NameAFL2
Aliasss475884112
rs267616529
AFL2_L14_42_1
dbSNP IDss475884112
SNP Array ID
480K SNP array for apple:AFL2
IRSC 9K SNP array for apple:AFL2
20K SNP array for apple:AFL2
50K SNP array for apple:AFL2
TypeSNP
SNP AllelesT/C
Probe 1AFL2.probe: AAGATAGCGGAGCTTGGGTTTACTGTGAAGACCCTCTTGGACATGACGGA
5' Flanking SequenceCTGCGGCGGCTGGTTGTACTTTGCGGCCGCCAGGTGAGCTTGGACTTGGAGGACTTGAGG ATTTGTTCCAGGCATATGGGGTCAGATACTACACGGCGGCAAAGATAGCGGAGCTTGGGT TTACTGTGAAGACCCTCTTGGACATGACGGA
3' Flanking SequenceGATGAGCTTGATGACATGATGAGCAGCCTCTCTCAGATATTCCGCTGGGAGTTGCTTGTT GGGGAGAGGTATGGTATCAAAGCTGCCGTCAGAGCCGAGCGTCGCCACCTTGATGAGGAG GACTCTCGGCGGCGCAACCATGTCTCTGGTG
SpeciesMalus x domestica
PolymorphismP_ AFL2
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeAFL2.probeMalus x domesticaprobe


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AFL2AFL2Malus x domesticamarker_locus


The following haplotype_block feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
Mdo-HB-14-24Mdo-HB-14-24Malus x domesticahaplotype_block


The following haplotype feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
2Mdo-HB-14-24_2Malus x domesticahaplotype
3Mdo-HB-14-24_3Malus x domesticahaplotype
4Mdo-HB-14-24_4Malus x domesticahaplotype
5Mdo-HB-14-24_5Malus x domesticahaplotype
6Mdo-HB-14-24_6Malus x domesticahaplotype
7Mdo-HB-14-24_7Malus x domesticahaplotype
8Mdo-HB-14-24_8Malus x domesticahaplotype
9Mdo-HB-14-24_9Malus x domesticahaplotype
10Mdo-HB-14-24_10Malus x domesticahaplotype
11Mdo-HB-14-24_11Malus x domesticahaplotype
12Mdo-HB-14-24_12Malus x domesticahaplotype
13Mdo-HB-14-24_13Malus x domesticahaplotype
14Mdo-HB-14-24_14Malus x domesticahaplotype
15Mdo-HB-14-24_15Malus x domesticahaplotype
16Mdo-HB-14-24_16Malus x domesticahaplotype
17Mdo-HB-14-24_17Malus x domesticahaplotype
18Mdo-HB-14-24_18Malus x domesticahaplotype
19Mdo-HB-14-24_19Malus x domesticahaplotype
20Mdo-HB-14-24_20Malus x domesticahaplotype
21Mdo-HB-14-24_21Malus x domesticahaplotype
22Mdo-HB-14-24_22Malus x domesticahaplotype
23Mdo-HB-14-24_23Malus x domesticahaplotype
24Mdo-HB-14-24_24Malus x domesticahaplotype
25Mdo-HB-14-24_25Malus x domesticahaplotype
26Mdo-HB-14-24_26Malus x domesticahaplotype
27Mdo-HB-14-24_27Malus x domesticahaplotype
28Mdo-HB-14-24_28Malus x domesticahaplotype
29Mdo-HB-14-24_29Malus x domesticahaplotype
30Mdo-HB-14-24_30Malus x domesticahaplotype
31Mdo-HB-14-24_31Malus x domesticahaplotype
32Mdo-HB-14-24_32Malus x domesticahaplotype
33Mdo-HB-14-24_33Malus x domesticahaplotype
34Mdo-HB-14-24_34Malus x domesticahaplotype
35Mdo-HB-14-24_35Malus x domesticahaplotype
36Mdo-HB-14-24_36Malus x domesticahaplotype
37Mdo-HB-14-24_37Malus x domesticahaplotype
38Mdo-HB-14-24_38Malus x domesticahaplotype
39Mdo-HB-14-24_39Malus x domesticahaplotype
40Mdo-HB-14-24_40Malus x domesticahaplotype
41Mdo-HB-14-24_41Malus x domesticahaplotype
42Mdo-HB-14-24_42Malus x domesticahaplotype
43Mdo-HB-14-24_43Malus x domesticahaplotype
44Mdo-HB-14-24_44Malus x domesticahaplotype
45Mdo-HB-14-24_45Malus x domesticahaplotype
46Mdo-HB-14-24_46Malus x domesticahaplotype
47Mdo-HB-14-24_47Malus x domesticahaplotype
48Mdo-HB-14-24_48Malus x domesticahaplotype
49Mdo-HB-14-24_49Malus x domesticahaplotype
50Mdo-HB-14-24_50Malus x domesticahaplotype
51Mdo-HB-14-24_51Malus x domesticahaplotype
52Mdo-HB-14-24_52Malus x domesticahaplotype
53Mdo-HB-14-24_53Malus x domesticahaplotype
54Mdo-HB-14-24_54Malus x domesticahaplotype
55Mdo-HB-14-24_55Malus x domesticahaplotype
56Mdo-HB-14-24_56Malus x domesticahaplotype
57Mdo-HB-14-24_57Malus x domesticahaplotype
58Mdo-HB-14-24_58Malus x domesticahaplotype
59Mdo-HB-14-24_59Malus x domesticahaplotype
60Mdo-HB-14-24_60Malus x domesticahaplotype
61Mdo-HB-14-24_61Malus x domesticahaplotype
62Mdo-HB-14-24_62Malus x domesticahaplotype
63Mdo-HB-14-24_63Malus x domesticahaplotype
64Mdo-HB-14-24_64Malus x domesticahaplotype
65Mdo-HB-14-24_65Malus x domesticahaplotype
66Mdo-HB-14-24_66Malus x domesticahaplotype
67Mdo-HB-14-24_67Malus x domesticahaplotype
68Mdo-HB-14-24_68Malus x domesticahaplotype
69Mdo-HB-14-24_69Malus x domesticahaplotype
70Mdo-HB-14-24_70Malus x domesticahaplotype
71Mdo-HB-14-24_71Malus x domesticahaplotype
72Mdo-HB-14-24_72Malus x domesticahaplotype
73Mdo-HB-14-24_73Malus x domesticahaplotype
74Mdo-HB-14-24_74Malus x domesticahaplotype
75Mdo-HB-14-24_75Malus x domesticahaplotype
76Mdo-HB-14-24_76Malus x domesticahaplotype
77Mdo-HB-14-24_77Malus x domesticahaplotype
78Mdo-HB-14-24_78Malus x domesticahaplotype
79Mdo-HB-14-24_79Malus x domesticahaplotype
80Mdo-HB-14-24_80Malus x domesticahaplotype
81Mdo-HB-14-24_81Malus x domesticahaplotype
82Mdo-HB-14-24_82Malus x domesticahaplotype
83Mdo-HB-14-24_83Malus x domesticahaplotype
84Mdo-HB-14-24_84Malus x domesticahaplotype
85Mdo-HB-14-24_85Malus x domesticahaplotype
86Mdo-HB-14-24_86Malus x domesticahaplotype
87Mdo-HB-14-24_87Malus x domesticahaplotype
88Mdo-HB-14-24_88Malus x domesticahaplotype
89Mdo-HB-14-24_89Malus x domesticahaplotype
90Mdo-HB-14-24_90Malus x domesticahaplotype
91Mdo-HB-14-24_91Malus x domesticahaplotype
92Mdo-HB-14-24_92Malus x domesticahaplotype
93Mdo-HB-14-24_93Malus x domesticahaplotype
94Mdo-HB-14-24_94Malus x domesticahaplotype
95Mdo-HB-14-24_95Malus x domesticahaplotype
96Mdo-HB-14-24_96Malus x domesticahaplotype
97Mdo-HB-14-24_97Malus x domesticahaplotype
98Mdo-HB-14-24_98Malus x domesticahaplotype
99Mdo-HB-14-24_99Malus x domesticahaplotype
100Mdo-HB-14-24_100Malus x domesticahaplotype
101Mdo-HB-14-24_101Malus x domesticahaplotype
102Mdo-HB-14-24_102Malus x domesticahaplotype
103Mdo-HB-14-24_103Malus x domesticahaplotype
104Mdo-HB-14-24_104Malus x domesticahaplotype
105Mdo-HB-14-24_105Malus x domesticahaplotype
106Mdo-HB-14-24_106Malus x domesticahaplotype
107Mdo-HB-14-24_107Malus x domesticahaplotype
108Mdo-HB-14-24_108Malus x domesticahaplotype
109Mdo-HB-14-24_109Malus x domesticahaplotype
110Mdo-HB-14-24_110Malus x domesticahaplotype
111Mdo-HB-14-24_111Malus x domesticahaplotype
112Mdo-HB-14-24_112Malus x domesticahaplotype
113Mdo-HB-14-24_113Malus x domesticahaplotype
114Mdo-HB-14-24_114Malus x domesticahaplotype
115Mdo-HB-14-24_115Malus x domesticahaplotype
116Mdo-HB-14-24_116Malus x domesticahaplotype
117Mdo-HB-14-24_117Malus x domesticahaplotype
118Mdo-HB-14-24_118Malus x domesticahaplotype
119Mdo-HB-14-24_119Malus x domesticahaplotype
120Mdo-HB-14-24_120Malus x domesticahaplotype
121Mdo-HB-14-24_121Malus x domesticahaplotype
122Mdo-HB-14-24_122Malus x domesticahaplotype
123Mdo-HB-14-24_123Malus x domesticahaplotype
124Mdo-HB-14-24_124Malus x domesticahaplotype
125Mdo-HB-14-24_125Malus x domesticahaplotype
126Mdo-HB-14-24_126Malus x domesticahaplotype
127Mdo-HB-14-24_127Malus x domesticahaplotype
128Mdo-HB-14-24_128Malus x domesticahaplotype
129Mdo-HB-14-24_129Malus x domesticahaplotype
130Mdo-HB-14-24_130Malus x domesticahaplotype
131Mdo-HB-14-24_131Malus x domesticahaplotype
132Mdo-HB-14-24_132Malus x domesticahaplotype
133Mdo-HB-14-24_133Malus x domesticahaplotype
134Mdo-HB-14-24_134Malus x domesticahaplotype
135Mdo-HB-14-24_135Malus x domesticahaplotype
136Mdo-HB-14-24_136Malus x domesticahaplotype
137Mdo-HB-14-24_137Malus x domesticahaplotype
138Mdo-HB-14-24_138Malus x domesticahaplotype
139Mdo-HB-14-24_139Malus x domesticahaplotype
140Mdo-HB-14-24_140Malus x domesticahaplotype
141Mdo-HB-14-24_141Malus x domesticahaplotype
142Mdo-HB-14-24_142Malus x domesticahaplotype
143Mdo-HB-14-24_143Malus x domesticahaplotype
144Mdo-HB-14-24_144Malus x domesticahaplotype
145Mdo-HB-14-24_145Malus x domesticahaplotype
146Mdo-HB-14-24_146Malus x domesticahaplotype
147Mdo-HB-14-24_147Malus x domesticahaplotype
148Mdo-HB-14-24_148Malus x domesticahaplotype
149Mdo-HB-14-24_149Malus x domesticahaplotype
150Mdo-HB-14-24_150Malus x domesticahaplotype
151Mdo-HB-14-24_151Malus x domesticahaplotype
152Mdo-HB-14-24_152Malus x domesticahaplotype
153Mdo-HB-14-24_153Malus x domesticahaplotype
154Mdo-HB-14-24_154Malus x domesticahaplotype
155Mdo-HB-14-24_155Malus x domesticahaplotype
156Mdo-HB-14-24_156Malus x domesticahaplotype
157Mdo-HB-14-24_157Malus x domesticahaplotype
158Mdo-HB-14-24_158Malus x domesticahaplotype
159Mdo-HB-14-24_159Malus x domesticahaplotype
160Mdo-HB-14-24_160Malus x domesticahaplotype
161Mdo-HB-14-24_161Malus x domesticahaplotype
162Mdo-HB-14-24_162Malus x domesticahaplotype
163Mdo-HB-14-24_163Malus x domesticahaplotype
164Mdo-HB-14-24_164Malus x domesticahaplotype
165Mdo-HB-14-24_165Malus x domesticahaplotype


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>AFL2 ID=AFL2|Name=AFL2|organism=Malus x domestica|type=genetic_marker|length=75bp
GGGTTTACTGTGAAGACCCTCTTGGACATGACGGA[C/T]GATGAGCTTG
ATGACATGATGAGCAGCCTCTCTCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-RosBREED-3.9K-201914N/A44.71AFL2View
2Apple-BB-F114N/A38.66AFL2View
3Apple-NC-F114N/A52.59AFL2View
4Apple-NCZFBB-consensus14N/A50.06AFL2View
5Apple-ZF-F114N/A50.2AFL2View
Alignments
Feature NameTypeLocationAnalysis
MDC010004.152 contig MDC010004.152:31396..31396. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr14 chromosome Chr14:23939667..23939667+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr14 chromosome Chr14:23939668..23939668. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation