RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1, RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1
Aliasss475877726
rs267610672
c475877726
SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1
AX-105200430
dbSNP IDss475877726
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1
50K SNP array for apple:RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTTGGTGATTGTGCTTGGGGTGGAATTGGTGGTTCG
3' Flanking SequenceGTTGTGGTGGAGTTGGTGGTTGGGATTGGGTTTG
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1Malus x domesticamarker_locus
RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1-92.81Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1 ID=RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1|Name=RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1|organism=Malus x domestica|type=genetic_marker|length=70bp
TTGGTGATTGTGCTTGGGGTGGAATTGGTGGTTCGRGTTGTGGTGGAGTT
GGTGGTTGGGATTGGGTTTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201310N/A93.09RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1View
2Apple-M432-2013-physical-Malus-domestica3N/A27691074RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1View
3Pear-PH-CG-2017LG3N/A92.81RosBREEDSNP_SNP_GA_27691074_Lg3_00607_MAF50_380398_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC008212.526 contig MDC008212.526:482..482. Malus x domestica Whole Genome v1.0 Assembly & Annotation