GDsnp01826, GDsnp01826 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp01826
dbSNP IDss475882259
SNP Array ID
IRSC 9K SNP array for apple:GDsnp01826
50K SNP array for apple:AX-105184620
TypeSNP
SNP AllelesA/G
5' Flanking SequenceCATTGCACAACTGTGATTACTACCTGATAAATGTA
3' Flanking SequenceCTTTCTGTGAATGAAAGCATAGGTAGATATTGGA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map1N/A3.2GDsnp01826View
2Apple-RosBREED-3.9K-20191N/A1.97GDsnp01826View
3Apple-Honeycrisp_Consensus-F11N/A1.97GDsnp01826View
Sequence
>GDsnp01826 ID=GDsnp01826; Name=GDsnp01826; organism=Malus x domestica; type=genetic_marker; length=70bp
CATTGCACAACTGTGATTACTACCTGATAAATGTARCTTTCTGTGAATGA
AAGCATAGGTAGATATTGGA