AFL1, AFL1 (genetic_marker) Malus x domestica

Marker Overview
NameAFL1
dbSNP IDss475884114
SNP Array ID
IRSC 9K SNP array for apple:AFL1
50K SNP array for apple:AX-105177934
TypeSNP
SNP AllelesT/G
5' Flanking SequenceGCTGCTCATCATGTCATCAAGCTCATCATCCTTCA
3' Flanking SequenceGTCCAAGAGGGTGTTCACAGTAAATCCAAGCTCC
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F16N/A32.5b475884114View
2Apple-Honeycrisp_Consensus-F16N/A40.58AFL1View
3Apple-NC-F16N/A45.92AFL1View
4Apple-NCZFBB-consensus6N/A42.82AFL1View
5Apple-ZF-F16N/A26.34AFL1View
Sequence
>AFL1 ID=AFL1; Name=AFL1; organism=Malus x domestica; type=genetic_marker; length=70bp
GCTGCTCATCATGTCATCAAGCTCATCATCCTTCAKGTCCAAGAGGGTGT
TCACAGTAAATCCAAGCTCC