RosBREEDSNP_SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5, RosBREEDSNP_SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5
dbSNP IDss475875768
SNP Array ID
480K SNP array for apple:AX-115183741
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5
20K SNP array for apple:RosBREEDSNP_SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5.probe: GATGCATCACAGCCTGAGTCAACATACATCAGATAAATAATAATGTTTGT
5' Flanking SequenceTATCCATCGCATTTTTTTGTTCTTTATTTTAATTGTTATGGCATTTTCTTTAGAGATGAT T
3' Flanking SequenceACAAACATTATTATTTATCTGATGTATGTTGACTCAGGCTGTGATGCATCAACAGCGCGC A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Libraries
Library NameType
20K SNP array for appleSNP_chip
480K SNP array for appleSNP_chip
IRSC 9K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A13.15SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5View
2Apple_HC64_F11N/A10.95SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5View
3Apple_HCMO_F11N/A45.9SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5View
4Apple_HGMM_Consenus1N/A54.69SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5View
5Apple-RosBREED-3.9K-20191N/A46.01SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5View
6Apple-MM-F11N/A52.1b475875768View
7apple-RosBREED-sweetness-2015LG1N/A69.8ss475875768View
8Apple-Honeycrisp_Consensus-F11N/A46.01RosBREEDSNP_SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5View
Sequence
>RosBREEDSNP_SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5 ID=RosBREEDSNP_SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5; Name=RosBREEDSNP_SNP_GA_31359482_Lg1_327822_MAF50_327822_exon5; organism=Malus x domestica; type=genetic_marker; length=75bp
TTTTAATTGTTATGGCATTTTCTTTAGAGATGATT[A/G]ACAAACATTA
TTATTTATCTGATGTATGTTGACTC