RosBREEDSNP_SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3, RosBREEDSNP_SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3
dbSNP IDss475881964
SNP Array ID
480K SNP array for apple:AX-105194864
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3
20K SNP array for apple:RosBREEDSNP_SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3
50K SNP array for apple:AX-105194864
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3.probe: GAAGACCCAAAACCTTGGGATTTAGTTAACTAGAAAAGAGGACAAACCTG
5' Flanking SequenceTTTAGTTAACTGAAGACCCAAAACCTTGGGATTTAGTTAACTAGAAAAGAGGACAAACCT G
3' Flanking SequenceGTCGCACGATAAAGAGTGCTGAAACTCACACTCCAGAGTCCATAAGCCACACTCTCTCGA A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F117N/A60.64SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3View
2Apple_HC64_F117N/A5.46SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3View
3Apple_HCMO_F117N/A191.4SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3View
4Apple_HGMM_Consenus17N/A6.96SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3View
5Apple-RGTxGD-F1-2015GD_17N/A6.12SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3View
6Apple-RosBREED-3.9K-201917N/A6.19SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3View
Sequence
>RosBREEDSNP_SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3 ID=RosBREEDSNP_SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3; Name=RosBREEDSNP_SNP_CT_1638129_Lg17_01205_MAF50_369576_exon3; organism=Malus x domestica; type=genetic_marker; length=75bp
TGGGATTTAGTTAACTAGAAAAGAGGACAAACCTG[C/T]GTCGCACGAT
AAAGAGTGCTGAAACTCACACTCCA
Alignments
Feature NameTypeLocationAnalysis
MDC013243.450 contig MDC013243.450:19074..19074. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr17 chromosome Chr17:1923726..1923726+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation