GDsnp00152, GDsnp00152 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp00152
Aliasss475882260
rs267615205
GD_00152_L1_42_1
GD_SNP00152
GD_SNP00152_F
dbSNP IDss475882260
SNP Array ID
480K SNP array for apple:AX-105213594
IRSC 9K SNP array for apple:GDsnp00152
20K SNP array for apple:GDsnp00152
TypeSNP
SNP AllelesT/C
Probe 1GDsnp00152.probe: AAGCCCATCTCTCTACCGTTTTCAAACGAAGGTGGAAGCTTGACAAACTC
5' Flanking SequenceTTCAGTTTTAGCTGTAGTTTCCAAGTTTCGAACAAAAGTGGACCTTTTGGAAGCCCATCT CTCTACCGTTTTCAAACGAAGGTGGAAGCTTGACAAACTC
ACGAAGGTGGAAGCTT GACAAACTC
3' Flanking SequenceGTAACATCAGTCCCCGGAACAGTTTCCTGCGCATGTCGATNGAGTAAGAAGCGGTCTTGA ATCACTAAGAGCATCTCCAATGGGAGTCCTTGAATAAGGA
GTAACATCAGTCCCCG GAACAGTTT
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Cindy F. Verdu
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2014Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2012Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745.
2014Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp00152GDsnp00152Malus x domesticamarker_locus
GD_SNP00152GD_SNP00152Malus x domesticamarker_locus
GDsnp00152GDsnp00152-2.572Malus x domesticamarker_locus


The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeGDsnp00152.probeMalus x domesticaprobe


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>GDsnp00152 ID=GDsnp00152|Name=GDsnp00152|organism=Malus x domestica|type=genetic_marker|length=201bp
TTCAGTTTTAGCTGTAGTTTCCAAGTTTCGAACAAAAGTGGACCTTTTGG
AAGCCCATCTCTCTACCGTTTTCAAACGAAGGTGGAAGCTTGACAAACTC
YGTAACATCAGTCCCCGGAACAGTTTCCTGCGCATGTCGATNGAGTAAGA
AGCGGTCTTGAATCACTAAGAGCATCTCCAATGGGAGTCCTTGAATAAGG
A
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A55.98GDsnp00152View
2Apple_HC64_F11N/A49.19GDsnp00152View
3Apple_HGMM_Consenus1N/A3.81GDsnp00152View
4Apple Integrated map1N/A4.1GDsnp00152View
5Apple-FjxPL-F1-2013LG1N/A9.65GDsnp00152View
6Apple-X3259X3263-F11N/A8.34GD_SNP00152View
7Apple-X5210X8402-F1-ConsensusLG1N/A0GD_SNP00152View
8Apple-X5210X8402-F1-X8402LG1N/A0GD_SNP00152View
9Apple-GDxBr-F1-2013LG1N/A6.65GD_SNP00152View
10Apple-Honeycrisp_Consensus-F11N/A2.57GDsnp00152-2.572View
Alignments
Feature NameTypeLocationAnalysis
MDC003525.99 contig MDC003525.99:4772..4772. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr01 chromosome Chr01:11967574..11967574- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr01 chromosome Chr01:11967524..11967624+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Cindy F. Verdu
First name:Cindy
Last name:Verdu
Title:Researcher
Institution:INRA
Address:INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:France
Email:cindyverdu@gmail.com