GDsnp01722, GDsnp01722 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp01722
dbSNP IDss475882780
SNP Array ID
IRSC 9K SNP array for apple:GDsnp01722
50K SNP array for apple:AX-105210847
TypeSNP
SNP AllelesT/C
5' Flanking SequenceCCAATTCGCTGGTGTGGTAGAGTAGTGATTCCATA
3' Flanking SequenceACAGCCTTAATCATGTACAGAAACTTAATATGTA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2013Troggio M, Surbanovski N, Bianco L, Moretto M, Giongo L, Banchi E, Viola R, Fernández FF, Costa F, Velasco R, Cestaro A, Sargent DJ. Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin. PloS one. 2013; 8(6):e67407.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map5N/A54.6GDsnp01722View
2Apple-M432-20135N/A42.6GDsnp01722View
3Apple-M432-2013-physical-Malus-domestica5N/A8498751GDsnp01722View
Sequence
>GDsnp01722 ID=GDsnp01722; Name=GDsnp01722; organism=Malus x domestica; type=genetic_marker; length=70bp
CCAATTCGCTGGTGTGGTAGAGTAGTGATTCCATAYACAGCCTTAATCAT
GTACAGAAACTTAATATGTA
Alignments
Feature NameTypeLocationAnalysis
MDC012104.398 contig MDC012104.398:6884..6884. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr05 chromosome Chr05:28868852..28868852. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation