RosBREEDSNP_SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1, RosBREEDSNP_SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1
dbSNP IDss475876648
SNP Array ID
480K SNP array for apple:AX-115182158
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1
20K SNP array for apple:RosBREEDSNP_SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1
50K SNP array for apple:AX-105202665
TypeSNP
SNP AllelesT/G
Probe 1RosBREEDSNP_SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1.probe: GCAAGCACAAGTCAGAGAATGTTGATAGGACGGCTGATTCCACGAATGTC
5' Flanking SequenceTGCTTCCATGCATGGTCTGCCAAAGAAGTCCCACTCGTGATGCCGAATCCAGATAGCTTA G
3' Flanking SequenceGACATTCGTGGAATCAGCCGTCCTATCAACATTCTCTGACTTGTGCTTGCTACTTTCGCC A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A57.6SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1View
2Apple_HC64_F11N/A50.99SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1View
3Apple_HCMO_F11N/A0SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1View
4Apple_HGMM_Consenus1N/A0SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1View
5Apple-Honeycrisp_Consensus-F11N/A0SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1View
6Apple-RosBREED-3.9K-20191N/A0SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1View
7Apple-BB-F11N/A3.82SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1View
8Apple-NC-F11N/A0.17SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1View
9Apple-NCZFBB-consensus1N/A0SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1View
10Apple-ZF-F11N/A0.57SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1View
11Apple-MM-F11N/A0.6c475876648View
12apple-RosBREED-sweetness-2015LG1N/A0.1ss475876648View
Sequence
>RosBREEDSNP_SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1 ID=RosBREEDSNP_SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1; Name=RosBREEDSNP_SNP_AC_121548_Lg1_00288_MAF30_MDP0000151845_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
AGTCCCACTCGTGATGCCGAATCCAGATAGCTTAG[A/C]GACATTCGTG
GAATCAGCCGTCCTATCAACATTCT