RosBREEDSNP_SNP_CT_14001081_Lg1_01889_MAF20_MDP0000824791_exon1, RosBREEDSNP_SNP_CT_14001081_Lg1_01889_MAF20_MDP0000824791_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_14001081_Lg1_01889_MAF20_MDP0000824791_exon1
dbSNP IDss475876728
SNP Array ID
480K SNP array for apple:AX-105183063
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_14001081_Lg1_01889_MAF20_MDP0000824791_exon1
20K SNP array for apple:RosBREEDSNP_SNP_CT_14001081_Lg1_01889_MAF20_MDP0000824791_exon1
50K SNP array for apple:AX-105183063
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_CT_14001081_Lg1_01889_MAF20_MDP0000824791_exon1.probe: TAATGGTGTTCCAAGACAACATCCAAATCAATCAGCGGCAGTGCCTTCTG
5' Flanking SequenceTTTAAAGGCCTTAATGGTGTTCCAAGACAACATCCAAATCAATCAGCGGCAGTGCCTTCT G
3' Flanking SequenceTGCTCGATATCTTCAGCTCAGCGTACGAATCAATAGCGGAGGAGATGAGACATAATCTTC G
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F11N/A17.8a475876728View
2Apple-Honeycrisp_Consensus-F11N/A13.48RosBREEDSNP_SNP_CT_14001081_Lg1_01889_MAF20_MDP0000824791_exon1View
3Apple-RosBREED-3.9K-20191N/A13.48RosBREEDSNP_SNP_CT_14001081_Lg1_01889_MAF20_MDP0000824791_exon1View
Sequence
>RosBREEDSNP_SNP_CT_14001081_Lg1_01889_MAF20_MDP0000824791_exon1 ID=RosBREEDSNP_SNP_CT_14001081_Lg1_01889_MAF20_MDP0000824791_exon1; Name=RosBREEDSNP_SNP_CT_14001081_Lg1_01889_MAF20_MDP0000824791_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
ACAACATCCAAATCAATCAGCGGCAGTGCCTTCTG[C/T]TGCTCGATAT
CTTCAGCTCAGCGTACGAATCAATA
Alignments
Feature NameTypeLocationAnalysis
MDC017479.419 contig MDC017479.419:3343..3343. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr01 chromosome Chr01:18223616..18223616+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation