RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3, RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3
Aliasss475879967
rs267612912
c475879967
SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3
AX-105220934
dbSNP IDss475879967
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3
50K SNP array for apple:RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3
TypeSNP
SNP AllelesA/C
5' Flanking SequenceTGAAATGCATAGAGAACACTAATATCTTTTGAAAA
3' Flanking SequenceCCCCCGTACTGCATTGAATCGCAAATTTCGAAAG
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3 ID=RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3|Name=RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3|organism=Malus x domestica|type=genetic_marker|length=70bp
TGAAATGCATAGAGAACACTAATATCTTTTGAAAAMCCCCCGTACTGCAT
TGAATCGCAAATTTCGAAAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201310N/A91.31RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3View
2Apple-M432-2013-physical-Malus-domestica10N/A34958317RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3View
3Apple-BB-F110N/A77.57RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3View
4Apple-NC-F110N/A98.98RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3View
5Apple-NCZFBB-consensus10N/A98.96RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3View
6Apple-ZF-F110N/A111.41RosBREEDSNP_SNP_AC_34958317_Lg10_00258_MAF20_MDP0000125820_exon3View
Alignments
Feature NameTypeLocationAnalysis
MDC010803.260 contig MDC010803.260:3763..3763. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr10 chromosome Chr10:39193334..39193334. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr10 chromosome Chr10:39193332..39193332. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation