RosBREEDSNP_SNP_AC_34196762_Lg11_02910_MAF30_MDP0000718803_exon2, RosBREEDSNP_SNP_AC_34196762_Lg11_02910_MAF30_MDP0000718803_exon2 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AC_34196762_Lg11_02910_MAF30_MDP0000718803_exon2
Aliasss475880287
rs267613232
c475880287
SNP_AC_34196762_Lg11_02910_MAF30_MDP0000718803_exon2
AX-105212225
dbSNP IDss475880287
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AC_34196762_Lg11_02910_MAF30_MDP0000718803_exon2
50K SNP array for apple:RosBREEDSNP_SNP_AC_34196762_Lg11_02910_MAF30_MDP0000718803_exon2
TypeSNP
SNP AllelesA/C
5' Flanking SequenceCCGGTTTGGCAGTGGGATCAACGTGCAACTTGTTG
3' Flanking SequenceAAGCCACATTGAGGTCAATACCCGGCATGTCAAA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_AC_34196762_Lg11_02910_MAF30_MDP0000718803_exon2RosBREEDSNP_SNP_AC_34196762_Lg11_02910_MAF30_MDP0000718803_exon2Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_AC_34196762_Lg11_02910_MAF30_MDP0000718803_exon2 ID=RosBREEDSNP_SNP_AC_34196762_Lg11_02910_MAF30_MDP0000718803_exon2|Name=RosBREEDSNP_SNP_AC_34196762_Lg11_02910_MAF30_MDP0000718803_exon2|organism=Malus x domestica|type=genetic_marker|length=70bp
CCGGTTTGGCAGTGGGATCAACGTGCAACTTGTTGMAAGCCACATTGAGG
TCAATACCCGGCATGTCAAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201310N/A36.18RosBREEDSNP_SNP_AC_34196762_Lg11_02910_MAF30_MDP0000718803_exon2View
2Apple-M432-2013-physical-Malus-domestica11N/A34196762RosBREEDSNP_SNP_AC_34196762_Lg11_02910_MAF30_MDP0000718803_exon2View
Alignments
Feature NameTypeLocationAnalysis
MDC011241.130 contig MDC011241.130:9552..9552. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr10 chromosome Chr10:16456939..16456939. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr10 chromosome Chr10:16456938..16456938. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation