RosBREEDSNP_SNP_GA_124604_Lg1_00288_MAF50_MDP0000929646_exon2, RosBREEDSNP_SNP_GA_124604_Lg1_00288_MAF50_MDP0000929646_exon2 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_124604_Lg1_00288_MAF50_MDP0000929646_exon2
dbSNP IDss475876649
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_124604_Lg1_00288_MAF50_MDP0000929646_exon2
50K SNP array for apple:AX-105190427
TypeSNP
SNP AllelesT/C
5' Flanking SequenceAACAAATTTCTCCCCTTGATGAGAAGTCGCTCTCC
3' Flanking SequenceCTCCTTCCTCAAAGAATGTGAAGACTTCGGCACCC
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F11N/A0.6c475876649View
2apple-RGxGS-F1-2015LG1N/A0RosBREEDSNP_SNP_GA_124604_Lg1_00288_MAF50_MDP0000929646_exon2View
3Apple-Honeycrisp_Consensus-F11N/A0RosBREEDSNP_SNP_GA_124604_Lg1_00288_MAF50_MDP0000929646_exon2View
4Apple-BB-F11N/A3.82RosBREEDSNP_SNP_GA_124604_Lg1_00288_MAF50_MDP0000929646_exon2View
5Apple-NC-F11N/A0.17RosBREEDSNP_SNP_GA_124604_Lg1_00288_MAF50_MDP0000929646_exon2View
6Apple-NCZFBB-consensus1N/A0RosBREEDSNP_SNP_GA_124604_Lg1_00288_MAF50_MDP0000929646_exon2View
7Apple-ZF-F11N/A0.57RosBREEDSNP_SNP_GA_124604_Lg1_00288_MAF50_MDP0000929646_exon2View
Sequence
>RosBREEDSNP_SNP_GA_124604_Lg1_00288_MAF50_MDP0000929646_exon2 ID=RosBREEDSNP_SNP_GA_124604_Lg1_00288_MAF50_MDP0000929646_exon2; Name=RosBREEDSNP_SNP_GA_124604_Lg1_00288_MAF50_MDP0000929646_exon2; organism=Malus x domestica; type=genetic_marker; length=71bp
AACAAATTTCTCCCCTTGATGAGAAGTCGCTCTCCYCTCCTTCCTCAAAG
AATGTGAAGACTTCGGCACCC