RosBREEDSNP_SNP_CA_5411076_Lg12_02212_MAF10_MDP0000766605_exon1, RosBREEDSNP_SNP_CA_5411076_Lg12_02212_MAF10_MDP0000766605_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CA_5411076_Lg12_02212_MAF10_MDP0000766605_exon1
dbSNP IDss475880408
SNP Array ID
480K SNP array for apple:AX-115182413
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CA_5411076_Lg12_02212_MAF10_MDP0000766605_exon1
20K SNP array for apple:RosBREEDSNP_SNP_CA_5411076_Lg12_02212_MAF10_MDP0000766605_exon1
50K SNP array for apple:AX-105192187
TypeSNP
SNP AllelesT/G
Probe 1RosBREEDSNP_SNP_CA_5411076_Lg12_02212_MAF10_MDP0000766605_exon1.probe: TGGCATACGCAAATAACTTCCTTCTATCCGCTATCCGACGACAACTTACC
5' Flanking SequenceAACAACTCGACGTGCAGCACCACCATCTCTAGTAGCCTTCTGAAGCAAAGTTGTACTCAA C
3' Flanking SequenceGGTAAGTTGTCGTCGGATAGCGGATAGAAGGAAGTTATTTGCGTATGCCATTGGCTTGAC G
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Associated WithGWAS0001248
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-RosBREED-3.9K-201912N/A10.99RosBREEDSNP_SNP_CA_5411076_Lg12_02212_MAF10_MDP0000766605_exon1View
2Apple-consensus-Allard-2016LG12N/A10RosBREEDSNP_SNP_CA_5411076_Lg12_02212_MAF10_MDP0000766605_exon1View
Sequence
>RosBREEDSNP_SNP_CA_5411076_Lg12_02212_MAF10_MDP0000766605_exon1 ID=RosBREEDSNP_SNP_CA_5411076_Lg12_02212_MAF10_MDP0000766605_exon1; Name=RosBREEDSNP_SNP_CA_5411076_Lg12_02212_MAF10_MDP0000766605_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
CTCTAGTAGCCTTCTGAAGCAAAGTTGTACTCAAC[A/C]GGTAAGTTGT
CGTCGGATAGCGGATAGAAGGAAGT
Annotated Terms
The following terms have been associated with this genetic_marker:
Vocabulary: Rosaceae Trait Ontology
TermDefinition
MAIN:000201210chlorogenic acid content
28:phloridzin contentphloridzin content
MAIN:000201221procyanidin B2 content
28:procyanidin B7 contentprocyanidin B7 content
MAIN:000201216unknown procyanidin oligomer 1 content