|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2010 | Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839. |
2013 | Troggio M, Surbanovski N, Bianco L, Moretto M, Giongo L, Banchi E, Viola R, Fernández FF, Costa F, Velasco R, Cestaro A, Sargent DJ. Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin. PloS one. 2013; 8(6):e67407. |
2014 | Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103. |
Sequence
>GDsnp00185 ID=GDsnp00185; Name=GDsnp00185; organism=Malus x domestica; type=genetic_marker; length=201bp GCCGCCGTCTCCCCTCTCCGATCTCCACAACCTACACATACACACAAAAA TTCNAACCCATCAAAAATCACACACATACACACAAATCTCTCTTTCTCTG MAACCTATACATACACAAACAGTTGTATCTATAGATCTCGCTTACCCGGA GGCGAATCGACAGAGGAGAGAACGCGATCGGAGAGTTCGATCGGAGGAAC C
|