RosBREEDSNP_SNP_GA_42727752_Lg15_01133_MAF40_1636710_exon4, RosBREEDSNP_SNP_GA_42727752_Lg15_01133_MAF40_1636710_exon4 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_42727752_Lg15_01133_MAF40_1636710_exon4
Aliasss475881580
rs267614525
SNP_GA_42727752_Lg15_01133_MAF40_1636710_exon4
dbSNP IDss475881580
SNP Array ID
IRSC 9K SNP array for apple:AX-105180385
480K SNP array for apple:AX-105180385
TypeSNP
SNP AllelesR
SpeciesMalus x domestica
PolymorphismP_ RosBREEDSNP_SNP_GA_42727752_Lg15_01133_MAF40_1636710_exon4
Publication[view all]
Libraries
Library NameType
480K SNP array for appleSNP_chip
IRSC 9K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_GA_42727752_Lg15_01133_MAF40_1636710_exon4RosBREEDSNP_SNP_GA_42727752_Lg15_01133_MAF40_1636710_exon4Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_GA_42727752_Lg15_01133_MAF40_1636710_exon4 ID=RosBREEDSNP_SNP_GA_42727752_Lg15_01133_MAF40_1636710_exon4|Name=RosBREEDSNP_SNP_GA_42727752_Lg15_01133_MAF40_1636710_exon4|organism=Malus x domestica|type=genetic_marker|length=75bp
GCTGATGAATTTCTTCCTGTCCTAATTTATGTTAC[A/G]TTAAAGGTAA
GACTAACTTTTATAATGGCTTGAAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201315N/A97.26RosBREEDSNP_SNP_GA_42727752_Lg15_01133_MAF40_1636710_exon4View
2Apple-M432-2013-physical-Malus-domestica15N/A42727752RosBREEDSNP_SNP_GA_42727752_Lg15_01133_MAF40_1636710_exon4View
Alignments
Feature NameTypeLocationAnalysis
MDC002206.331 contig MDC002206.331:7808..7808. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr15 chromosome Chr15:43257525..43257525- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr15 chromosome Chr15:43257526..43257525. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation